EMAIL THIS PAGE TO A FRIEND

TRAF4

TNF receptor-associated factor 4

Synonyms: CART1 MLN62 RNF83
UniProtKB ID: Q9BUZ4, O75615, Q14848, Q2KJU4, Q2PJN8
Gene ID:
Human(9618) Summary: This gene encodes a member of the TNF receptor associated factor (TRAF) family. TRAF proteins are associated with, and mediate signal transduction from members of the TNF receptor superfamily. The encoded protein has been shown to interact with neurotrophin receptor, p75 (NTR/NTSR1), and negatively regulate NTR induced cell death and NF-kappa B activation. This protein has been found to bind to p47phox, a cytosolic regulatory factor included in a multi-protein complex known as NAD(P)H oxidase. This protein thus, is thought to be involved in the oxidative activation of MAPK8/JNK. Alternatively spliced transcript variants have been observed but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
Mouse(22032) TNF receptor associated factor 4
Rat(303285) Tnf receptor associated factor 4
naked mole-rat(101716536) TNF receptor-associated factor 4
domestic guinea pig(100723177) TNF receptor-associated factor 4
cow(781568) TNF receptor-associated factor 4
sheep(101107451) TNF receptor-associated factor 4
fruit fly(33638) TNF-receptor-associated factor 4
dog(100688511) TNF receptor-associated factor 4
Horse(100072085) TNF receptor-associated factor 4
domestic cat(101096365) TNF receptor-associated factor 4
chicken(417577) TNF receptor-associated factor 4
Gene Class: Apoptosis
109 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009423 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009423 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009423 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004295 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004295 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004295 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004295 Rosetta Predictions human pricing
NM_145751 Rosetta Predictions human pricing
NM_001107017 Rosetta Predictions rat pricing
NM_009423 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004295 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00337300 predicted 1500
2 SASI_Hs02_00337301 predicted 699
3 SASI_Hs02_00337302 predicted 559
4 SASI_Hs02_00337303 predicted 1044
5 SASI_Hs02_00337304 predicted 695
6 SASI_Hs02_00337305 predicted 1437
7 SASI_Hs02_00337306 predicted 774
8 SASI_Hs02_00337307 predicted 1444
9 SASI_Hs02_00337308 predicted 810
10 SASI_Hs02_00337309 predicted 469
11 SASI_Hs01_00082683 predicted 262
12 SASI_Hs01_00082684 predicted 1701
13 SASI_Hs01_00082685 predicted 321
14 SASI_Hs01_00082686 predicted 248
15 SASI_Hs01_00082687 predicted 220
16 SASI_Hs01_00082688 predicted 1768
17 SASI_Hs01_00082689 predicted 1768
18 SASI_Hs01_00082690 predicted 1771
19 SASI_Hs01_00082691 predicted 1593
20 SASI_Hs01_00082692 predicted 1595
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145751 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00188381 predicted 259
2 SASI_Hs01_00188382 predicted 887
3 SASI_Hs01_00188383 predicted 325
4 SASI_Hs01_00188384 predicted 246
5 SASI_Hs01_00188385 predicted 218
6 SASI_Hs01_00188386 predicted 951
7 SASI_Hs01_00188387 predicted 945
8 SASI_Hs01_00188388 predicted 964
9 SASI_Hs01_00188389 predicted 775
10 SASI_Hs01_00188390 predicted 778
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107017 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00224666 predicted 315
2 SASI_Rn02_00224667 predicted 495
3 SASI_Rn02_00224668 predicted 668
4 SASI_Rn02_00224669 predicted 1702
5 SASI_Rn02_00224670 predicted 294
6 SASI_Rn02_00224671 predicted 1018
7 SASI_Rn02_00224672 predicted 874
8 SASI_Rn02_00224673 predicted 1084
9 SASI_Rn02_00224674 predicted 1474
10 SASI_Rn02_00224675 predicted 375
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009423 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316080 predicted 1087
2 SASI_Mm02_00316081 predicted 1874
3 SASI_Mm02_00316082 predicted 1265
4 SASI_Mm02_00316083 predicted 1993
5 SASI_Mm02_00316084 predicted 1027
6 SASI_Mm02_00316085 predicted 1203
7 SASI_Mm02_00316086 predicted 1131
8 SASI_Mm02_00316087 predicted 373
9 SASI_Mm02_00316088 predicted 670
10 SASI_Mm02_00316089 predicted 420
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009423
VALIDATED
TRAF4 MISSION shRNA Bacterial Glycerol Stock
TNF receptor-associated factor 4
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000067743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009423.2-1090s1c1
Sequence:CCGGCCCAGCCTTCTATACGCATAACTCGAGTTATGCGTATAGAAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009423.2-672s1c1
Sequence:CCGGGTGCCTACTGTACCAAGGAATCTCGAGATTCCTTGGTACAGTAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009423.2-391s1c1
Sequence:CCGGCCACTTGAACACTTGCAGCTTCTCGAGAAGCTGCAAGTGTTCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009423.2-577s1c1
Sequence:CCGGGAGTGTGTACTGTGAGAACAACTCGAGTTGTTCTCACAGTACACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000067746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009423.2-1430s1c1
Sequence:CCGGCGGAACTACGTGCGGGATGATCTCGAGATCATCCCGCACGTAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009423.3-1176s21c1
Sequence:CCGGCTCCATCTACATCCGTGTCTTCTCGAGAAGACACGGATGTAGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009423.3-1033s21c1
Sequence:CCGGAGCTATGGGCGTCGTCTACAACTCGAGTTGTAGACGACGCCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009423.3-2860s21c1
Sequence:CCGGGCGTATAGTTCCCACTAATTTCTCGAGAAATTAGTGGGAACTATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009423.3-980s21c1
Sequence:CCGGAGCTGGAAGAACTATCCATAGCTCGAGCTATGGATAGTTCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000238144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009423.3-891s21c1
Sequence:CCGGTCACGTGGAGGAGAGCGTAAACTCGAGTTTACGCTCTCCTCCACGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009423
VALIDATED
TRAF4 MISSION shRNA shRNA Plasmid DNA
TNF receptor-associated factor 4
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000067743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009423.2-1090s1c1
Sequence:CCGGCCCAGCCTTCTATACGCATAACTCGAGTTATGCGTATAGAAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009423.2-672s1c1
Sequence:CCGGGTGCCTACTGTACCAAGGAATCTCGAGATTCCTTGGTACAGTAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009423.2-391s1c1
Sequence:CCGGCCACTTGAACACTTGCAGCTTCTCGAGAAGCTGCAAGTGTTCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009423.2-577s1c1
Sequence:CCGGGAGTGTGTACTGTGAGAACAACTCGAGTTGTTCTCACAGTACACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000067746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009423.2-1430s1c1
Sequence:CCGGCGGAACTACGTGCGGGATGATCTCGAGATCATCCCGCACGTAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009423.3-1176s21c1
Sequence:CCGGCTCCATCTACATCCGTGTCTTCTCGAGAAGACACGGATGTAGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009423.3-1033s21c1
Sequence:CCGGAGCTATGGGCGTCGTCTACAACTCGAGTTGTAGACGACGCCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009423.3-2860s21c1
Sequence:CCGGGCGTATAGTTCCCACTAATTTCTCGAGAAATTAGTGGGAACTATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009423.3-980s21c1
Sequence:CCGGAGCTGGAAGAACTATCCATAGCTCGAGCTATGGATAGTTCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000238144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009423.3-891s21c1
Sequence:CCGGTCACGTGGAGGAGAGCGTAAACTCGAGTTTACGCTCTCCTCCACGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009423
VALIDATED
TRAF4 MISSION shRNA Lentiviral Transduction Particles
TNF receptor-associated factor 4
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000067743    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009423.2-1090s1c1
Sequence:CCGGCCCAGCCTTCTATACGCATAACTCGAGTTATGCGTATAGAAGGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067745    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009423.2-672s1c1
Sequence:CCGGGTGCCTACTGTACCAAGGAATCTCGAGATTCCTTGGTACAGTAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067744    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009423.2-391s1c1
Sequence:CCGGCCACTTGAACACTTGCAGCTTCTCGAGAAGCTGCAAGTGTTCAAGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067747    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009423.2-577s1c1
Sequence:CCGGGAGTGTGTACTGTGAGAACAACTCGAGTTGTTCTCACAGTACACACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000067746    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009423.2-1430s1c1
Sequence:CCGGCGGAACTACGTGCGGGATGATCTCGAGATCATCCCGCACGTAGTTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238143    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009423.3-1176s21c1
Sequence:CCGGCTCCATCTACATCCGTGTCTTCTCGAGAAGACACGGATGTAGATGGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009423.3-1033s21c1
Sequence:CCGGAGCTATGGGCGTCGTCTACAACTCGAGTTGTAGACGACGCCCATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_009423.3-2860s21c1
Sequence:CCGGGCGTATAGTTCCCACTAATTTCTCGAGAAATTAGTGGGAACTATACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009423.3-980s21c1
Sequence:CCGGAGCTGGAAGAACTATCCATAGCTCGAGCTATGGATAGTTCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000238144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_009423.3-891s21c1
Sequence:CCGGTCACGTGGAGGAGAGCGTAAACTCGAGTTTACGCTCTCCTCCACGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004295
TRAF4 MISSION shRNA Bacterial Glycerol Stock
TNF receptor-associated factor 4
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000034243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004295.2-1411s1c1
Sequence:CCGGCCAGGACATTCGAAAGCGAAACTCGAGTTTCGCTTTCGAATGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004295.2-1427s1c1
Sequence:CCGGCGAAACTATGTGCGGGATGATCTCGAGATCATCCCGCACATAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004295.2-1314s1c1
Sequence:CCGGCCGACCCAAACTGGAAGAATTCTCGAGAATTCTTCCAGTTTGGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004295.2-572s1c1
Sequence:CCGGGAGAGTGTCTACTGTGAGAATCTCGAGATTCTCACAGTAGACACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000034241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004295.2-294s1c1
Sequence:CCGGCGGAGCTGGAAGTACAAGTATCTCGAGATACTTGTACTTCCAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004295.3-598s21c1
Sequence:CCGGAGTGTCTACTGTGAGAATAAGCTCGAGCTTATTCTCACAGTAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004295.3-401s21c1
Sequence:CCGGATCTACAGGGCCACCTGAATACTCGAGTATTCAGGTGGCCCTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000368580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004295.3-701s21c1
Sequence:CCGGGCACTAAGGAGTTCGTCTTTGCTCGAGCAAAGACGAACTCCTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004295.3-319s21c1
Sequence:CCGGGAGCTGGAAGTACAAGTATTGCTCGAGCAATACTTGTACTTCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004295
TRAF4 MISSION shRNA shRNA Plasmid DNA
TNF receptor-associated factor 4
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000034243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004295.2-1411s1c1
Sequence:CCGGCCAGGACATTCGAAAGCGAAACTCGAGTTTCGCTTTCGAATGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004295.2-1427s1c1
Sequence:CCGGCGAAACTATGTGCGGGATGATCTCGAGATCATCCCGCACATAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004295.2-1314s1c1
Sequence:CCGGCCGACCCAAACTGGAAGAATTCTCGAGAATTCTTCCAGTTTGGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004295.2-572s1c1
Sequence:CCGGGAGAGTGTCTACTGTGAGAATCTCGAGATTCTCACAGTAGACACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000034241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004295.2-294s1c1
Sequence:CCGGCGGAGCTGGAAGTACAAGTATCTCGAGATACTTGTACTTCCAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004295.3-598s21c1
Sequence:CCGGAGTGTCTACTGTGAGAATAAGCTCGAGCTTATTCTCACAGTAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004295.3-401s21c1
Sequence:CCGGATCTACAGGGCCACCTGAATACTCGAGTATTCAGGTGGCCCTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000368580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004295.3-701s21c1
Sequence:CCGGGCACTAAGGAGTTCGTCTTTGCTCGAGCAAAGACGAACTCCTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004295.3-319s21c1
Sequence:CCGGGAGCTGGAAGTACAAGTATTGCTCGAGCAATACTTGTACTTCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004295
TRAF4 MISSION shRNA Lentiviral Transduction Particles
TNF receptor-associated factor 4
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000034243    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004295.2-1411s1c1
Sequence:CCGGCCAGGACATTCGAAAGCGAAACTCGAGTTTCGCTTTCGAATGTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034239    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004295.2-1427s1c1
Sequence:CCGGCGAAACTATGTGCGGGATGATCTCGAGATCATCCCGCACATAGTTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034240    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004295.2-1314s1c1
Sequence:CCGGCCGACCCAAACTGGAAGAATTCTCGAGAATTCTTCCAGTTTGGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004295.2-572s1c1
Sequence:CCGGGAGAGTGTCTACTGTGAGAATCTCGAGATTCTCACAGTAGACACTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000034241    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004295.2-294s1c1
Sequence:CCGGCGGAGCTGGAAGTACAAGTATCTCGAGATACTTGTACTTCCAGCTCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004295.3-598s21c1
Sequence:CCGGAGTGTCTACTGTGAGAATAAGCTCGAGCTTATTCTCACAGTAGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358640    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004295.3-401s21c1
Sequence:CCGGATCTACAGGGCCACCTGAATACTCGAGTATTCAGGTGGCCCTGTAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000368580    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004295.3-701s21c1
Sequence:CCGGGCACTAAGGAGTTCGTCTTTGCTCGAGCAAAGACGAACTCCTTAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004295.3-319s21c1
Sequence:CCGGGAGCTGGAAGTACAAGTATTGCTCGAGCAATACTTGTACTTCCAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks