EMAIL THIS PAGE TO A FRIEND

TRAF5

TNF receptor-associated factor 5

Synonyms: MGC:39780 RNF84
UniProtKB ID: O00463, Q6FHY1
Gene ID:
Human(7188) Summary: The scaffold protein encoded by this gene is a member of the tumor necrosis factor receptor-associated factor (TRAF) protein family and contains a meprin and TRAF homology (MATH) domain, a RING-type zinc finger, and two TRAF-type zinc fingers. TRAF proteins are associated with, and mediate signal transduction from members of the TNF receptor superfamily. This protein is one of the components of a multiple protein complex which binds to tumor necrosis factor (TNF) receptor cytoplasmic domains and mediates TNF-induced activation. Alternate transcriptional splice variants have been characterized. [provided by RefSeq, Jul 2008]
Mouse(22033) TNF receptor-associated factor 5
Zebrafish(563887) Tnf receptor-associated factor 5
chicken(374055) TNF receptor-associated factor 5
dog(480019) TNF receptor-associated factor 5
Horse(100055119) TNF receptor-associated factor 5
domestic cat(101086032) TNF receptor-associated factor 5
cow(507234) TNF receptor-associated factor 5
sheep(101119408) TNF receptor-associated factor 5
domestic guinea pig(100721722) TNF receptor-associated factor 5
naked mole-rat(101704164) TNF receptor-associated factor 5
Domestic Rabbit(100340005) TNF receptor-associated factor 5
Gene Class: Apoptosis
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_004619 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004619 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004619 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011633 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011633 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011633 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU060831 MISSION® esiRNA esiRNA human TRAF5 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001033910 Rosetta Predictions human pricing
NM_004619 Rosetta Predictions human pricing
NM_145759 Rosetta Predictions human pricing
NM_011633 Rosetta Predictions mouse pricing
XM_887055 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033910 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00115809 predicted 1662
2 SASI_Hs01_00115810 predicted 635
3 SASI_Hs02_00308110 predicted 311
4 SASI_Hs01_00115811 predicted 1177
5 SASI_Hs01_00115812 predicted 729
6 SASI_Hs01_00115813 predicted 1009
7 SASI_Hs01_00115814 predicted 1165
8 SASI_Hs01_00115816 predicted 347
9 SASI_Hs01_00115817 predicted 390
10 SASI_Hs02_00308111 predicted 1072
11 SASI_Hs01_00115815 predicted 382
12 SASI_Hs01_00115818 predicted 1137
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004619 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018164 predicted 1669
2 SASI_Hs01_00018165 predicted 643
3 SASI_Hs02_00338014 predicted 316
4 SASI_Hs01_00018166 predicted 1183
5 SASI_Hs01_00018167 predicted 727
6 SASI_Hs01_00018168 predicted 1020
7 SASI_Hs01_00018169 predicted 1173
8 SASI_Hs01_00018171 predicted 356
9 SASI_Hs01_00018172 predicted 400
10 SASI_Hs02_00338015 predicted 1085
11 SASI_Hs01_00018170 predicted 386
12 SASI_Hs01_00018173 predicted 1146
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145759 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00038673 predicted 1675
2 SASI_Hs01_00038674 predicted 642
3 SASI_Hs02_00365345 predicted 318
4 SASI_Hs01_00038675 predicted 1184
5 SASI_Hs01_00038676 predicted 727
6 SASI_Hs01_00038677 predicted 1017
7 SASI_Hs01_00038678 predicted 1170
8 SASI_Hs01_00038680 predicted 357
9 SASI_Hs01_00038681 predicted 397
10 SASI_Hs02_00365346 predicted 1087
11 SASI_Hs01_00038679 predicted 395
12 SASI_Hs01_00038682 predicted 1152
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011633 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00058434 predicted 988
2 SASI_Mm01_00058435 predicted 1329
3 SASI_Mm01_00058436 predicted 672
4 SASI_Mm01_00058437 predicted 1917
5 SASI_Mm01_00058438 predicted 1997
6 SASI_Mm01_00058439 predicted 813
7 SASI_Mm01_00058440 predicted 1345
8 SASI_Mm01_00058441 predicted 1446
9 SASI_Mm01_00058442 predicted 622
10 SASI_Mm01_00058443 predicted 540
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_887055 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00279558 predicted 690
2 SASI_Mm01_00279559 predicted 698
3 SASI_Mm01_00279560 predicted 388
4 SASI_Mm01_00279561 predicted 576
5 SASI_Mm01_00279562 predicted 822
6 SASI_Mm01_00279563 predicted 652
7 SASI_Mm01_00279564 predicted 401
8 SASI_Mm01_00279565 predicted 561
9 SASI_Mm01_00279566 predicted 805
10 SASI_Mm01_00279567 predicted 435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004619
VALIDATED
TRAF5 MISSION shRNA Bacterial Glycerol Stock
TNF receptor-associated factor 5
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000367578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004619.3-404s21c1
Sequence:CCGGGATGTAATGCCAAGGTTATTCCTCGAGGAATAACCTTGGCATTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004619.3-146s21c1
Sequence:CCGGCCAGTATAGAGTACCAGTTTGCTCGAGCAAACTGGTACTCTATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004619.3-173s21c1
Sequence:CCGGGGTTGGAAGAGCGCTACAAATCTCGAGATTTGTAGCGCTCTTCCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004619.3-2030s21c1
Sequence:CCGGCAGTGTCTCGGGCACTCTAAACTCGAGTTTAGAGTGCCCGAGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004619.3-1655s21c1
Sequence:CCGGATGCCAAGAACGCCTACATTACTCGAGTAATGTAGGCGTTCTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_004619.3-1027s21c1
Sequence:CCGGGAAGCTCAAGTGCATCAATTACTCGAGTAATTGATGCACTTGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004619.3-648s21c1
Sequence:CCGGCAACAATTGTGCGAAGATTATCTCGAGATAATCTTCGCACAATTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000367636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004619.3-742s21c1
Sequence:CCGGGGCTGTGCTGTAACGGATAAACTCGAGTTTATCCGTTACAGCACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004619.2-2462s1c1
Sequence:CCGGGCTGCATAAGAACTGGTGAATCTCGAGATTCACCAGTTCTTATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004619.2-672s1c1
Sequence:CCGGCCTGTCAGTTTCGAAAGGAAACTCGAGTTTCCTTTCGAAACTGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004619.2-1381s1c1
Sequence:CCGGGCTGGAGGGTACTTGCTATAACTCGAGTTATAGCAAGTACCCTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004619.2-278s1c1
Sequence:CCGGCCCAGTATAGAGTACCAGTTTCTCGAGAAACTGGTACTCTATACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004619.2-436s1c1
Sequence:CCGGCCCTGTAGATAAAGAGGTCATCTCGAGATGACCTCTTTATCTACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004619
VALIDATED
TRAF5 MISSION shRNA shRNA Plasmid DNA
TNF receptor-associated factor 5
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000367578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004619.3-404s21c1
Sequence:CCGGGATGTAATGCCAAGGTTATTCCTCGAGGAATAACCTTGGCATTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004619.3-146s21c1
Sequence:CCGGCCAGTATAGAGTACCAGTTTGCTCGAGCAAACTGGTACTCTATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004619.3-173s21c1
Sequence:CCGGGGTTGGAAGAGCGCTACAAATCTCGAGATTTGTAGCGCTCTTCCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004619.3-2030s21c1
Sequence:CCGGCAGTGTCTCGGGCACTCTAAACTCGAGTTTAGAGTGCCCGAGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004619.3-1655s21c1
Sequence:CCGGATGCCAAGAACGCCTACATTACTCGAGTAATGTAGGCGTTCTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_004619.3-1027s21c1
Sequence:CCGGGAAGCTCAAGTGCATCAATTACTCGAGTAATTGATGCACTTGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004619.3-648s21c1
Sequence:CCGGCAACAATTGTGCGAAGATTATCTCGAGATAATCTTCGCACAATTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000367636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004619.3-742s21c1
Sequence:CCGGGGCTGTGCTGTAACGGATAAACTCGAGTTTATCCGTTACAGCACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004619.2-2462s1c1
Sequence:CCGGGCTGCATAAGAACTGGTGAATCTCGAGATTCACCAGTTCTTATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004619.2-672s1c1
Sequence:CCGGCCTGTCAGTTTCGAAAGGAAACTCGAGTTTCCTTTCGAAACTGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004619.2-1381s1c1
Sequence:CCGGGCTGGAGGGTACTTGCTATAACTCGAGTTATAGCAAGTACCCTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004619.2-278s1c1
Sequence:CCGGCCCAGTATAGAGTACCAGTTTCTCGAGAAACTGGTACTCTATACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004619.2-436s1c1
Sequence:CCGGCCCTGTAGATAAAGAGGTCATCTCGAGATGACCTCTTTATCTACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004619
VALIDATED
TRAF5 MISSION shRNA Lentiviral Transduction Particles
TNF receptor-associated factor 5
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000367578    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004619.3-404s21c1
Sequence:CCGGGATGTAATGCCAAGGTTATTCCTCGAGGAATAACCTTGGCATTACATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356136    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004619.3-146s21c1
Sequence:CCGGCCAGTATAGAGTACCAGTTTGCTCGAGCAAACTGGTACTCTATACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356104    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004619.3-173s21c1
Sequence:CCGGGGTTGGAAGAGCGCTACAAATCTCGAGATTTGTAGCGCTCTTCCAACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367514    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004619.3-2030s21c1
Sequence:CCGGCAGTGTCTCGGGCACTCTAAACTCGAGTTTAGAGTGCCCGAGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367544    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004619.3-1655s21c1
Sequence:CCGGATGCCAAGAACGCCTACATTACTCGAGTAATGTAGGCGTTCTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356133    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 2 Clone ID:NM_004619.3-1027s21c1
Sequence:CCGGGAAGCTCAAGTGCATCAATTACTCGAGTAATTGATGCACTTGAGCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356131    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_004619.3-648s21c1
Sequence:CCGGCAACAATTGTGCGAAGATTATCTCGAGATAATCTTCGCACAATTGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000367636    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004619.3-742s21c1
Sequence:CCGGGGCTGTGCTGTAACGGATAAACTCGAGTTTATCCGTTACAGCACAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007343    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004619.2-2462s1c1
Sequence:CCGGGCTGCATAAGAACTGGTGAATCTCGAGATTCACCAGTTCTTATGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007347    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004619.2-672s1c1
Sequence:CCGGCCTGTCAGTTTCGAAAGGAAACTCGAGTTTCCTTTCGAAACTGACAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007346    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: A549
TRC Version: 1 Clone ID:NM_004619.2-1381s1c1
Sequence:CCGGGCTGGAGGGTACTTGCTATAACTCGAGTTATAGCAAGTACCCTCCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007344    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004619.2-278s1c1
Sequence:CCGGCCCAGTATAGAGTACCAGTTTCTCGAGAAACTGGTACTCTATACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007345    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004619.2-436s1c1
Sequence:CCGGCCCTGTAGATAAAGAGGTCATCTCGAGATGACCTCTTTATCTACAGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011633
VALIDATED
TRAF5 MISSION shRNA Bacterial Glycerol Stock
TNF receptor-associated factor 5
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000313587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011633.1-1791s21c1
Sequence:CCGGGCGGCAAGAAGAACCATATTGCTCGAGCAATATGGTTCTTCTTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011633.1-2014s21c1
Sequence:CCGGGAAACTTCTCAGCACAGGAAACTCGAGTTTCCTGTGCTGAGAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000317086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011633.1-529s21c1
Sequence:CCGGCCGGTCTCTGAGAGAATTGAACTCGAGTTCAATTCTCTCAGAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011633.1-666s21c1
Sequence:CCGGGGTGCAATGCCAGGATTATTCCTCGAGGAATAATCCTGGCATTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000349960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011633.1-1486s21c1
Sequence:CCGGTAAGAACGAAGAGCGGTTTAACTCGAGTTAAACCGCTCTTCGTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011633.1-2014s1c1
Sequence:CCGGGAAACTTCTCAGCACAGGAAACTCGAGTTTCCTGTGCTGAGAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011633.1-675s1c1
Sequence:CCGGCCAGGATTATTCTGGGACGATCTCGAGATCGTCCCAGAATAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011633.1-382s1c1
Sequence:CCGGCAACTCAATTTCCTTGGACTTCTCGAGAAGTCCAAGGAAATTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011633.1-529s1c1
Sequence:CCGGCCGGTCTCTGAGAGAATTGAACTCGAGTTCAATTCTCTCAGAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011633.1-938s1c1
Sequence:CCGGGCTAGGGTGAATGAACACCTTCTCGAGAAGGTGTTCATTCACCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011633
VALIDATED
TRAF5 MISSION shRNA shRNA Plasmid DNA
TNF receptor-associated factor 5
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000313587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011633.1-1791s21c1
Sequence:CCGGGCGGCAAGAAGAACCATATTGCTCGAGCAATATGGTTCTTCTTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011633.1-2014s21c1
Sequence:CCGGGAAACTTCTCAGCACAGGAAACTCGAGTTTCCTGTGCTGAGAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000317086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011633.1-529s21c1
Sequence:CCGGCCGGTCTCTGAGAGAATTGAACTCGAGTTCAATTCTCTCAGAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011633.1-666s21c1
Sequence:CCGGGGTGCAATGCCAGGATTATTCCTCGAGGAATAATCCTGGCATTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000349960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011633.1-1486s21c1
Sequence:CCGGTAAGAACGAAGAGCGGTTTAACTCGAGTTAAACCGCTCTTCGTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011633.1-2014s1c1
Sequence:CCGGGAAACTTCTCAGCACAGGAAACTCGAGTTTCCTGTGCTGAGAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011633.1-675s1c1
Sequence:CCGGCCAGGATTATTCTGGGACGATCTCGAGATCGTCCCAGAATAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011633.1-382s1c1
Sequence:CCGGCAACTCAATTTCCTTGGACTTCTCGAGAAGTCCAAGGAAATTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011633.1-529s1c1
Sequence:CCGGCCGGTCTCTGAGAGAATTGAACTCGAGTTCAATTCTCTCAGAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011633.1-938s1c1
Sequence:CCGGGCTAGGGTGAATGAACACCTTCTCGAGAAGGTGTTCATTCACCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011633
VALIDATED
TRAF5 MISSION shRNA Lentiviral Transduction Particles
TNF receptor-associated factor 5
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000313587    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011633.1-1791s21c1
Sequence:CCGGGCGGCAAGAAGAACCATATTGCTCGAGCAATATGGTTCTTCTTGCCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317087    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011633.1-2014s21c1
Sequence:CCGGGAAACTTCTCAGCACAGGAAACTCGAGTTTCCTGTGCTGAGAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000317086    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011633.1-529s21c1
Sequence:CCGGCCGGTCTCTGAGAGAATTGAACTCGAGTTCAATTCTCTCAGAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011633.1-666s21c1
Sequence:CCGGGGTGCAATGCCAGGATTATTCCTCGAGGAATAATCCTGGCATTGCACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000349960    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011633.1-1486s21c1
Sequence:CCGGTAAGAACGAAGAGCGGTTTAACTCGAGTTAAACCGCTCTTCGTTCTTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040718    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011633.1-2014s1c1
Sequence:CCGGGAAACTTCTCAGCACAGGAAACTCGAGTTTCCTGTGCTGAGAAGTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011633.1-675s1c1
Sequence:CCGGCCAGGATTATTCTGGGACGATCTCGAGATCGTCCCAGAATAATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040721    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011633.1-382s1c1
Sequence:CCGGCAACTCAATTTCCTTGGACTTCTCGAGAAGTCCAAGGAAATTGAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040722    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011633.1-529s1c1
Sequence:CCGGCCGGTCTCTGAGAGAATTGAACTCGAGTTCAATTCTCTCAGAGACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040720    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_011633.1-938s1c1
Sequence:CCGGGCTAGGGTGAATGAACACCTTCTCGAGAAGGTGTTCATTCACCCTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks