EMAIL THIS PAGE TO A FRIEND

TRAF6

TNF receptor-associated factor 6, E3 ubiquitin protein ligase

Synonyms: MGC:3310 RNF85
UniProtKB ID: Q9Y4K3, A6NKI7, A8KAB3, D3DR16, Q8NEH5
Gene ID:
Human(7189) Summary: The protein encoded by this gene is a member of the TNF receptor associated factor (TRAF) protein family. TRAF proteins are associated with, and mediate signal transduction from, members of the TNF receptor superfamily. This protein mediates signaling from members of the TNF receptor superfamily as well as the Toll/IL-1 family. Signals from receptors such as CD40, TNFSF11/RANCE and IL-1 have been shown to be mediated by this protein. This protein also interacts with various protein kinases including IRAK1/IRAK, SRC and PKCzeta, which provides a link between distinct signaling pathways. This protein functions as a signal transducer in the NF-kappaB pathway that activates IkappaB kinase (IKK) in response to proinflammatory cytokines. The interaction of this protein with UBE2N/UBC13, and UBE2V1/UEV1A, which are ubiquitin conjugating enzymes catalyzing the formation of polyubiquitin chains, has been found to be required for IKK activation by this protein. This protein also interacts with the transforming growth factor (TGF) beta receptor complex and is required for Smad-independent activation of the JNK and p38 kinases. This protein has an amino terminal RING domain which is followed by four zinc-finger motifs, a central coiled-coil region and a highly conserved carboxyl terminal domain, known as the TRAF-C domain. Two alternatively spliced transcript variants, encoding an identical protein, have been reported. [provided by RefSeq, Feb 2012]
Mouse(22034) TNF receptor-associated factor 6
Rat(311245) TNF receptor-associated factor 6, E3 ubiquitin protein ligase
Domestic Rabbit(100343190) TNF receptor-associated factor 6, E3 ubiquitin protein ligase
naked mole-rat(101697126) TNF receptor-associated factor 6, E3 ubiquitin protein ligase
domestic guinea pig(100724447) TNF receptor-associated factor 6, E3 ubiquitin protein ligase
cow(539124) TNF receptor-associated factor 6
sheep(101107132) TNF receptor-associated factor 6, E3 ubiquitin protein ligase
fruit fly(31746) TNF-receptor-associated factor 6
domestic cat(101099750) TNF receptor-associated factor 6, E3 ubiquitin protein ligase
dog(100688110) TNF receptor-associated factor 6, E3 ubiquitin protein ligase
chicken(423163) TNF receptor-associated factor 6, E3 ubiquitin protein ligase
Zebrafish(554561) TNF receptor-associated factor 6
Gene Class: Apoptosis
98 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_009424 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009424 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009424 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004620 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004620 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004620 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004620 Rosetta Predictions human pricing
NM_145803 Rosetta Predictions human pricing
NM_001107754 Rosetta Predictions rat pricing
NM_009424 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004620 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00116390 predicted 675
2 SASI_Hs01_00116391 predicted 619
3 SASI_Hs01_00116392 predicted 1116
4 SASI_Hs01_00116393 predicted 1256
5 SASI_Hs01_00116394 predicted 769
6 SASI_Hs01_00116395 predicted 859
7 SASI_Hs01_00116397 predicted 1073
8 SASI_Hs01_00116398 predicted 547
9 SASI_Hs01_00116399 predicted 1697
10 SASI_Hs02_00338016 predicted 563
11 SASI_Hs01_00116396 predicted 918
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_145803 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00224533 predicted 770
2 SASI_Hs01_00224534 predicted 705
3 SASI_Hs01_00224535 predicted 1212
4 SASI_Hs01_00224536 predicted 1347
5 SASI_Hs01_00224537 predicted 867
6 SASI_Hs01_00224538 predicted 951
7 SASI_Hs01_00224540 predicted 1157
8 SASI_Hs01_00224541 predicted 641
9 SASI_Hs01_00224542 predicted 1788
10 SASI_Hs02_00365358 predicted 663
11 SASI_Hs01_00224539 predicted 1009
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107754 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231935 predicted 1660
2 SASI_Rn02_00231936 predicted 705
3 SASI_Rn02_00231937 predicted 947
4 SASI_Rn02_00231938 predicted 1119
5 SASI_Rn02_00231939 predicted 857
6 SASI_Rn02_00231940 predicted 470
7 SASI_Rn02_00231941 predicted 869
8 SASI_Rn02_00231942 predicted 1318
9 SASI_Rn02_00231943 predicted 1677
10 SASI_Rn02_00231944 predicted 1283
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009424 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316090 predicted 795
2 SASI_Mm02_00316091 predicted 1877
3 SASI_Mm01_00036471 predicted 1400
4 SASI_Mm01_00036472 predicted 1077
5 SASI_Mm01_00036473 predicted 920
6 SASI_Mm01_00036474 predicted 744
7 SASI_Mm01_00036475 predicted 1344
8 SASI_Mm01_00036476 predicted 1497
9 SASI_Mm01_00036477 predicted 596
10 SASI_Mm01_00036478 predicted 1190
11 SASI_Mm01_00036470 predicted 715
12 SASI_Mm01_00036479 predicted 1722
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009424
VALIDATED
TRAF6 MISSION shRNA Bacterial Glycerol Stock
TNF receptor-associated factor 6, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000040733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009424.2-2478s1c1
Sequence:CCGGCCTGTGAATTTCAGAGGCTTTCTCGAGAAAGCCTCTGAAATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009424.2-1227s1c1
Sequence:CCGGCCCAGGCTGTTCATAATGTTACTCGAGTAACATTATGAACAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009424.2-680s1c1
Sequence:CCGGGCCTGCATCATCAAATCCATACTCGAGTATGGATTTGATGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009424.2-1306s1c1
Sequence:CCGGCCCAAATTATGAGGAAACTATCTCGAGATAGTTTCCTCATAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009424.2-921s1c1
Sequence:CCGGGCCAGGTTAATACACACATTACTCGAGTAATGTGTGTATTAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009424
VALIDATED
TRAF6 MISSION shRNA shRNA Plasmid DNA
TNF receptor-associated factor 6, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000040733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009424.2-2478s1c1
Sequence:CCGGCCTGTGAATTTCAGAGGCTTTCTCGAGAAAGCCTCTGAAATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009424.2-1227s1c1
Sequence:CCGGCCCAGGCTGTTCATAATGTTACTCGAGTAACATTATGAACAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009424.2-680s1c1
Sequence:CCGGGCCTGCATCATCAAATCCATACTCGAGTATGGATTTGATGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009424.2-1306s1c1
Sequence:CCGGCCCAAATTATGAGGAAACTATCTCGAGATAGTTTCCTCATAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009424.2-921s1c1
Sequence:CCGGGCCAGGTTAATACACACATTACTCGAGTAATGTGTGTATTAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009424
VALIDATED
TRAF6 MISSION shRNA Lentiviral Transduction Particles
TNF receptor-associated factor 6, E3 ubiquitin protein ligase
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000040733    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009424.2-2478s1c1
Sequence:CCGGCCTGTGAATTTCAGAGGCTTTCTCGAGAAAGCCTCTGAAATTCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009424.2-1227s1c1
Sequence:CCGGCCCAGGCTGTTCATAATGTTACTCGAGTAACATTATGAACAGCCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040736    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_009424.2-680s1c1
Sequence:CCGGGCCTGCATCATCAAATCCATACTCGAGTATGGATTTGATGATGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009424.2-1306s1c1
Sequence:CCGGCCCAAATTATGAGGAAACTATCTCGAGATAGTTTCCTCATAATTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040737    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009424.2-921s1c1
Sequence:CCGGGCCAGGTTAATACACACATTACTCGAGTAATGTGTGTATTAACCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004620
TRAF6 MISSION shRNA Bacterial Glycerol Stock
TNF receptor-associated factor 6, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004620.2-1585s1c1
Sequence:CCGGCGAAGAGATAATGGATGCCAACTCGAGTTGGCATCCATTATCTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004620.2-1124s1c1
Sequence:CCGGCGGAATTTCCAGGAAACTATTCTCGAGAATAGTTTCCTGGAAATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004620.2-1901s1c1
Sequence:CCGGGCCACGGGAAATATGTAATATCTCGAGATATTACATATTTCCCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004620.2-458s1c1
Sequence:CCGGCCCATCTGCTTGATGGCATTACTCGAGTAATGCCATCAAGCAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004620.2-1379s1c1
Sequence:CCGGCCTGGATTCTACACTGGCAAACTCGAGTTTGCCAGTGTAGAATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004620.2-1938s21c1
Sequence:CCGGTTAGAGAGGTCACTTACTATTCTCGAGAATAGTAAGTGACCTCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004620.2-1077s21c1
Sequence:CCGGTTCATAGTTTGAGCGTTATACCTCGAGGTATAACGCTCAAACTATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004620.2-1111s21c1
Sequence:CCGGTATCTCAGAGGTCCGGAATTTCTCGAGAAATTCCGGACCTCTGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004620.2-2139s21c1
Sequence:CCGGTCCAGACTCAAGAGTACTAAACTCGAGTTTAGTACTCTTGAGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004620
TRAF6 MISSION shRNA shRNA Plasmid DNA
TNF receptor-associated factor 6, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004620.2-1585s1c1
Sequence:CCGGCGAAGAGATAATGGATGCCAACTCGAGTTGGCATCCATTATCTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004620.2-1124s1c1
Sequence:CCGGCGGAATTTCCAGGAAACTATTCTCGAGAATAGTTTCCTGGAAATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004620.2-1901s1c1
Sequence:CCGGGCCACGGGAAATATGTAATATCTCGAGATATTACATATTTCCCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004620.2-458s1c1
Sequence:CCGGCCCATCTGCTTGATGGCATTACTCGAGTAATGCCATCAAGCAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004620.2-1379s1c1
Sequence:CCGGCCTGGATTCTACACTGGCAAACTCGAGTTTGCCAGTGTAGAATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004620.2-1938s21c1
Sequence:CCGGTTAGAGAGGTCACTTACTATTCTCGAGAATAGTAAGTGACCTCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004620.2-1077s21c1
Sequence:CCGGTTCATAGTTTGAGCGTTATACCTCGAGGTATAACGCTCAAACTATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004620.2-1111s21c1
Sequence:CCGGTATCTCAGAGGTCCGGAATTTCTCGAGAAATTCCGGACCTCTGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004620.2-2139s21c1
Sequence:CCGGTCCAGACTCAAGAGTACTAAACTCGAGTTTAGTACTCTTGAGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004620
TRAF6 MISSION shRNA Lentiviral Transduction Particles
TNF receptor-associated factor 6, E3 ubiquitin protein ligase
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004620.2-1585s1c1
Sequence:CCGGCGAAGAGATAATGGATGCCAACTCGAGTTGGCATCCATTATCTCTTCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004620.2-1124s1c1
Sequence:CCGGCGGAATTTCCAGGAAACTATTCTCGAGAATAGTTTCCTGGAAATTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007348    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_004620.2-1901s1c1
Sequence:CCGGGCCACGGGAAATATGTAATATCTCGAGATATTACATATTTCCCGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007351    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004620.2-458s1c1
Sequence:CCGGCCCATCTGCTTGATGGCATTACTCGAGTAATGCCATCAAGCAGATGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004620.2-1379s1c1
Sequence:CCGGCCTGGATTCTACACTGGCAAACTCGAGTTTGCCAGTGTAGAATCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356146    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004620.2-1938s21c1
Sequence:CCGGTTAGAGAGGTCACTTACTATTCTCGAGAATAGTAAGTGACCTCTCTAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356117    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004620.2-1077s21c1
Sequence:CCGGTTCATAGTTTGAGCGTTATACCTCGAGGTATAACGCTCAAACTATGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356118    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004620.2-1111s21c1
Sequence:CCGGTATCTCAGAGGTCCGGAATTTCTCGAGAAATTCCGGACCTCTGAGATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356147    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004620.2-2139s21c1
Sequence:CCGGTCCAGACTCAAGAGTACTAAACTCGAGTTTAGTACTCTTGAGTCTGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks