EMAIL THIS PAGE TO A FRIEND

TRAF7

TNF receptor-associated factor 7, E3 ubiquitin protein ligase

Synonyms: RFWD1 RNF119
UniProtKB ID: Q6Q0C0, Q9H073
Gene ID:
Human(84231) Summary: Tumor necrosis factor (TNF; see MIM 191160) receptor-associated factors, such as TRAF7, are signal transducers for members of the TNF receptor superfamily (see MIM 191190). TRAFs are composed of an N-terminal cysteine/histidine-rich region containing zinc RING and/or zinc finger motifs; a coiled-coil (leucine zipper) motif; and a homologous region that defines the TRAF family, the TRAF domain, which is involved in self-association and receptor binding.[supplied by OMIM, Apr 2004]
Mouse(224619) TNF receptor-associated factor 7
Rat(360491) TNF receptor-associated factor 7, E3 ubiquitin protein ligase
Zebrafish(563746) TNF receptor-associated factor 7
dog(609824) TNF receptor-associated factor 7, E3 ubiquitin protein ligase
Horse(100065698) TNF receptor-associated factor 7, E3 ubiquitin protein ligase
domestic cat(101082031) TNF receptor-associated factor 7, E3 ubiquitin protein ligase
chicken(416555) TNF receptor-associated factor 7, E3 ubiquitin protein ligase
cow(511692) TNF receptor-associated factor 7
sheep(101114158) TNF receptor-associated factor 7, E3 ubiquitin protein ligase
domestic guinea pig(100733170) TNF receptor-associated factor 7, E3 ubiquitin protein ligase
naked mole-rat(101711929) TNF receptor-associated factor 7, E3 ubiquitin protein ligase
100 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_153792 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_153792 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_153792 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_032271 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_032271 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_032271 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_032271 Rosetta Predictions human pricing
NM_206835 Rosetta Predictions human pricing
NM_001127548 Rosetta Predictions rat pricing
NM_153792 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_032271 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00359584 predicted 1192
2 SASI_Hs02_00359585 predicted 1804
3 SASI_Hs02_00359586 predicted 2430
4 SASI_Hs02_00359587 predicted 2091
5 SASI_Hs01_00189042 predicted 1587
6 SASI_Hs01_00189043 predicted 1106
7 SASI_Hs01_00189047 predicted 882
8 SASI_Hs02_00359588 predicted 891
9 SASI_Hs02_00359589 predicted 1365
10 SASI_Hs02_00359590 predicted 2419
11 SASI_Hs01_00189038 predicted 977
12 SASI_Hs01_00189039 predicted 845
13 SASI_Hs01_00189040 predicted 1785
14 SASI_Hs01_00189041 predicted 1934
15 SASI_Hs01_00189044 predicted 584
16 SASI_Hs01_00189045 predicted 1466
17 SASI_Hs01_00189046 predicted 1052
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_206835 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00233211 predicted 839
2 SASI_Hs01_00233212 predicted 851
3 SASI_Hs01_00233213 predicted 929
4 SASI_Hs01_00233214 predicted 802
5 SASI_Hs01_00233215 predicted 426
6 SASI_Hs01_00233216 predicted 534
7 SASI_Hs01_00233217 predicted 111
8 SASI_Hs01_00233218 predicted 337
9 SASI_Hs01_00233219 predicted 168
10 SASI_Hs01_00233220 predicted 494
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001127548 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00254233 predicted 913
2 SASI_Rn02_00254234 predicted 912
3 SASI_Rn02_00254235 predicted 870
4 SASI_Rn02_00254236 predicted 879
5 SASI_Rn02_00254237 predicted 636
6 SASI_Rn02_00254238 predicted 695
7 SASI_Rn02_00254239 predicted 1727
8 SASI_Rn02_00254240 predicted 2139
9 SASI_Rn02_00254241 predicted 906
10 SASI_Rn02_00254242 predicted 1226
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_153792 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00091355 predicted 907
2 SASI_Mm01_00091356 predicted 1838
3 SASI_Mm01_00091357 predicted 2056
4 SASI_Mm01_00091358 predicted 666
5 SASI_Mm02_00343523 predicted 949
6 SASI_Mm01_00091359 predicted 1762
7 SASI_Mm01_00091360 predicted 1505
8 SASI_Mm01_00091361 predicted 1446
9 SASI_Mm01_00091362 predicted 725
10 SASI_Mm01_00091363 predicted 1626
11 SASI_Mm01_00091354 predicted 954
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_153792
VALIDATED
TRAF7 MISSION shRNA Bacterial Glycerol Stock
TNF receptor-associated factor 7, E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000302807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153792.1-632s21c1
Sequence:CCGGGCTGACAGTAGTGGTGAACAACTCGAGTTGTTCACCACTACTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153792.1-794s21c1
Sequence:CCGGCCACGAGAGTAGTTGTGACTACTCGAGTAGTCACAACTACTCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153792.1-881s21c1
Sequence:CCGGCCTGAAAGAATGCGAGCACATCTCGAGATGTGCTCGCATTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153792.1-2364s21c1
Sequence:CCGGCCACCGTTCATATCACTCCATCTCGAGATGGAGTGATATGAACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000302811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153792.1-1827s21c1
Sequence:CCGGGCTGTGACGAATCACCACATTCTCGAGAATGTGGTGATTCGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153792.1-2364s1c1
Sequence:CCGGCCACCGTTCATATCACTCCATCTCGAGATGGAGTGATATGAACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153792.1-1827s1c1
Sequence:CCGGGCTGTGACGAATCACCACATTCTCGAGAATGTGGTGATTCGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153792.1-632s1c1
Sequence:CCGGGCTGACAGTAGTGGTGAACAACTCGAGTTGTTCACCACTACTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153792.1-794s1c1
Sequence:CCGGCCACGAGAGTAGTTGTGACTACTCGAGTAGTCACAACTACTCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153792.1-881s1c1
Sequence:CCGGCCTGAAAGAATGCGAGCACATCTCGAGATGTGCTCGCATTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_153792
VALIDATED
TRAF7 MISSION shRNA shRNA Plasmid DNA
TNF receptor-associated factor 7, E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000302807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153792.1-632s21c1
Sequence:CCGGGCTGACAGTAGTGGTGAACAACTCGAGTTGTTCACCACTACTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153792.1-794s21c1
Sequence:CCGGCCACGAGAGTAGTTGTGACTACTCGAGTAGTCACAACTACTCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153792.1-881s21c1
Sequence:CCGGCCTGAAAGAATGCGAGCACATCTCGAGATGTGCTCGCATTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153792.1-2364s21c1
Sequence:CCGGCCACCGTTCATATCACTCCATCTCGAGATGGAGTGATATGAACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000302811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153792.1-1827s21c1
Sequence:CCGGGCTGTGACGAATCACCACATTCTCGAGAATGTGGTGATTCGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153792.1-2364s1c1
Sequence:CCGGCCACCGTTCATATCACTCCATCTCGAGATGGAGTGATATGAACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153792.1-1827s1c1
Sequence:CCGGGCTGTGACGAATCACCACATTCTCGAGAATGTGGTGATTCGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153792.1-632s1c1
Sequence:CCGGGCTGACAGTAGTGGTGAACAACTCGAGTTGTTCACCACTACTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153792.1-794s1c1
Sequence:CCGGCCACGAGAGTAGTTGTGACTACTCGAGTAGTCACAACTACTCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153792.1-881s1c1
Sequence:CCGGCCTGAAAGAATGCGAGCACATCTCGAGATGTGCTCGCATTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_153792
VALIDATED
TRAF7 MISSION shRNA Lentiviral Transduction Particles
TNF receptor-associated factor 7, E3 ubiquitin protein ligase
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000302807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_153792.1-632s21c1
Sequence:CCGGGCTGACAGTAGTGGTGAACAACTCGAGTTGTTCACCACTACTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302735    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153792.1-794s21c1
Sequence:CCGGCCACGAGAGTAGTTGTGACTACTCGAGTAGTCACAACTACTCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302734    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153792.1-881s21c1
Sequence:CCGGCCTGAAAGAATGCGAGCACATCTCGAGATGTGCTCGCATTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302810    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153792.1-2364s21c1
Sequence:CCGGCCACCGTTCATATCACTCCATCTCGAGATGGAGTGATATGAACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000302811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_153792.1-1827s21c1
Sequence:CCGGGCTGTGACGAATCACCACATTCTCGAGAATGTGGTGATTCGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040973    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153792.1-2364s1c1
Sequence:CCGGCCACCGTTCATATCACTCCATCTCGAGATGGAGTGATATGAACGGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040975    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153792.1-1827s1c1
Sequence:CCGGGCTGTGACGAATCACCACATTCTCGAGAATGTGGTGATTCGTCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040977    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_153792.1-632s1c1
Sequence:CCGGGCTGACAGTAGTGGTGAACAACTCGAGTTGTTCACCACTACTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040976    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153792.1-794s1c1
Sequence:CCGGCCACGAGAGTAGTTGTGACTACTCGAGTAGTCACAACTACTCTCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040974    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_153792.1-881s1c1
Sequence:CCGGCCTGAAAGAATGCGAGCACATCTCGAGATGTGCTCGCATTCTTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_032271
VALIDATED
TRAF7 MISSION shRNA Bacterial Glycerol Stock
TNF receptor-associated factor 7, E3 ubiquitin protein ligase
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032271.2-1165s1c1
Sequence:CCGGCGGGACGCATCCATGTTAAATCTCGAGATTTAACATGGATGCGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_032271.2-1785s1c1
Sequence:CCGGCTACTCCATTGCTGTGACAAACTCGAGTTTGTCACAGCAATGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_032271.2-2087s1c1
Sequence:CCGGGCACTGTGAAGGTTTGGACTTCTCGAGAAGTCCAAACCTTCACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_032271.2-180s1c1
Sequence:CCGGGACCAGAATGGAAACGACCTTCTCGAGAAGGTCGTTTCCATTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_032271.2-1053s1c1
Sequence:CCGGGCTGGGAAAGCTCTCGGAGAACTCGAGTTCTCCGAGAGCTTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_032271
VALIDATED
TRAF7 MISSION shRNA shRNA Plasmid DNA
TNF receptor-associated factor 7, E3 ubiquitin protein ligase
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032271.2-1165s1c1
Sequence:CCGGCGGGACGCATCCATGTTAAATCTCGAGATTTAACATGGATGCGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_032271.2-1785s1c1
Sequence:CCGGCTACTCCATTGCTGTGACAAACTCGAGTTTGTCACAGCAATGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_032271.2-2087s1c1
Sequence:CCGGGCACTGTGAAGGTTTGGACTTCTCGAGAAGTCCAAACCTTCACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_032271.2-180s1c1
Sequence:CCGGGACCAGAATGGAAACGACCTTCTCGAGAAGGTCGTTTCCATTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_032271.2-1053s1c1
Sequence:CCGGGCTGGGAAAGCTCTCGGAGAACTCGAGTTCTCCGAGAGCTTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_032271
VALIDATED
TRAF7 MISSION shRNA Lentiviral Transduction Particles
TNF receptor-associated factor 7, E3 ubiquitin protein ligase
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056948    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_032271.2-1165s1c1
Sequence:CCGGCGGGACGCATCCATGTTAAATCTCGAGATTTAACATGGATGCGTCCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056949    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 1 Clone ID:NM_032271.2-1785s1c1
Sequence:CCGGCTACTCCATTGCTGTGACAAACTCGAGTTTGTCACAGCAATGGAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056950    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1 Clone ID:NM_032271.2-2087s1c1
Sequence:CCGGGCACTGTGAAGGTTTGGACTTCTCGAGAAGTCCAAACCTTCACAGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056951    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_032271.2-180s1c1
Sequence:CCGGGACCAGAATGGAAACGACCTTCTCGAGAAGGTCGTTTCCATTCTGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056952    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: A549
TRC Version: 1 Clone ID:NM_032271.2-1053s1c1
Sequence:CCGGGCTGGGAAAGCTCTCGGAGAACTCGAGTTCTCCGAGAGCTTTCCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks