EMAIL THIS PAGE TO A FRIEND

TRAFD1

TRAF-type zinc finger domain containing 1

Synonyms: FLN29
UniProtKB ID: O14545, A8K5L6
Gene ID:
Human(10906) Summary: The innate immune system confers host defense against viral and microbial infection, and TRAFD1 is a negative feedback regulator that controls excessive immune responses (Sanada et al., 2008 [PubMed 18849341]
Mouse(231712) TRAF type zinc finger domain containing 1
Rat(114635) TRAF type zinc finger domain containing 1
naked mole-rat(101702625) TRAF-type zinc finger domain containing 1
Domestic Rabbit(100339269) TRAF-type zinc finger domain containing 1
domestic guinea pig(100721298) TRAF-type zinc finger domain containing 1
cow(512642) TRAF-type zinc finger domain containing 1
sheep(101115231) TRAF-type zinc finger domain containing 1
chicken(416884) TRAF-type zinc finger domain containing 1
domestic cat(101084489) TRAF-type zinc finger domain containing 1
dog(477484) TRAF-type zinc finger domain containing 1
76 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006700 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006700 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006700 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029574 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029574 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029574 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_172275 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172275 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172275 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006700 Rosetta Predictions human pricing
XM_001076427 Rosetta Predictions rat pricing
XM_341086 Rosetta Predictions rat pricing
NM_172275 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006700 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00012181 predicted 389
2 SASI_Hs01_00012182 predicted 1088
3 SASI_Hs01_00012183 predicted 1794
4 SASI_Hs01_00012184 predicted 913
5 SASI_Hs01_00012185 predicted 1437
6 SASI_Hs01_00012187 predicted 485
7 SASI_Hs01_00012188 predicted 1413
8 SASI_Hs01_00012189 predicted 960
9 SASI_Hs01_00012190 predicted 634
10 SASI_Hs02_00342125 predicted 757
11 SASI_Hs01_00012186 predicted 365
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076427 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353166 predicted 1685
2 SASI_Rn02_00353167 predicted 1069
3 SASI_Rn02_00353168 predicted 1185
4 SASI_Rn02_00353169 predicted 624
5 SASI_Rn02_00353170 predicted 1469
6 SASI_Rn02_00353171 predicted 1641
7 SASI_Rn02_00353172 predicted 1178
8 SASI_Rn02_00353173 predicted 841
9 SASI_Rn02_00353174 predicted 707
10 SASI_Rn02_00353175 predicted 1520
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_341086 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00141476 predicted 2262
2 SASI_Rn01_00141477 predicted 2032
3 SASI_Rn01_00141478 predicted 2137
4 SASI_Rn01_00141479 predicted 2255
5 SASI_Rn02_00392329 predicted 2027
6 SASI_Rn01_00141480 predicted 2180
7 SASI_Rn01_00141481 predicted 2024
8 SASI_Rn01_00141482 predicted 2319
9 SASI_Rn01_00141484 predicted 2335
10 SASI_Rn02_00392330 predicted 2270
11 SASI_Rn01_00141483 predicted 2272
12 SASI_Rn01_00141485 predicted 2313
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172275 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00087384 predicted 980
2 SASI_Mm01_00087385 predicted 1407
3 SASI_Mm01_00087386 predicted 885
4 SASI_Mm01_00087388 predicted 1101
5 SASI_Mm01_00087389 predicted 1589
6 SASI_Mm01_00087390 predicted 537
7 SASI_Mm01_00087391 predicted 1098
8 SASI_Mm01_00087392 predicted 331
9 SASI_Mm01_00087393 predicted 977
10 SASI_Mm02_00343756 predicted 1414
11 SASI_Mm01_00087387 predicted 750
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006700
VALIDATED
TRAFD1 MISSION shRNA Bacterial Glycerol Stock
TRAF-type zinc finger domain containing 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000004990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006700.1-671s1c1
Sequence:CCGGCCCAGGTTTCAATTCAGAATACTCGAGTATTCTGAATTGAAACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006700.1-2303s1c1
Sequence:CCGGGTCTGTCAGTAACGAGGCTTTCTCGAGAAAGCCTCGTTACTGACAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006700.1-172s1c1
Sequence:CCGGCCTACCTGTAAGGAACCATTTCTCGAGAAATGGTTCCTTACAGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006700.1-1148s1c1
Sequence:CCGGGCATCATTATCCCATGTGAATCTCGAGATTCACATGGGATAATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000004991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006700.1-881s1c1
Sequence:CCGGCCAGGTCTCTCAGTGACATAACTCGAGTTATGTCACTGAGAGACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006700.2-1180s21c1
Sequence:CCGGGCATCATTATCCCATGTGAATCTCGAGATTCACATGGGATAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000279992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006700.2-703s21c1
Sequence:CCGGCCCAGGTTTCAATTCAGAATACTCGAGTATTCTGAATTGAAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006700.2-2335s21c1
Sequence:CCGGGTCTGTCAGTAACGAGGCTTTCTCGAGAAAGCCTCGTTACTGACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000280059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006700.2-913s21c1
Sequence:CCGGCCAGGTCTCTCAGTGACATAACTCGAGTTATGTCACTGAGAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006700
VALIDATED
TRAFD1 MISSION shRNA shRNA Plasmid DNA
TRAF-type zinc finger domain containing 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000004990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006700.1-671s1c1
Sequence:CCGGCCCAGGTTTCAATTCAGAATACTCGAGTATTCTGAATTGAAACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006700.1-2303s1c1
Sequence:CCGGGTCTGTCAGTAACGAGGCTTTCTCGAGAAAGCCTCGTTACTGACAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006700.1-172s1c1
Sequence:CCGGCCTACCTGTAAGGAACCATTTCTCGAGAAATGGTTCCTTACAGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006700.1-1148s1c1
Sequence:CCGGGCATCATTATCCCATGTGAATCTCGAGATTCACATGGGATAATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000004991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006700.1-881s1c1
Sequence:CCGGCCAGGTCTCTCAGTGACATAACTCGAGTTATGTCACTGAGAGACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006700.2-1180s21c1
Sequence:CCGGGCATCATTATCCCATGTGAATCTCGAGATTCACATGGGATAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000279992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006700.2-703s21c1
Sequence:CCGGCCCAGGTTTCAATTCAGAATACTCGAGTATTCTGAATTGAAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006700.2-2335s21c1
Sequence:CCGGGTCTGTCAGTAACGAGGCTTTCTCGAGAAAGCCTCGTTACTGACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000280059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006700.2-913s21c1
Sequence:CCGGCCAGGTCTCTCAGTGACATAACTCGAGTTATGTCACTGAGAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006700
VALIDATED
TRAFD1 MISSION shRNA Lentiviral Transduction Particles
TRAF-type zinc finger domain containing 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000004990    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006700.1-671s1c1
Sequence:CCGGCCCAGGTTTCAATTCAGAATACTCGAGTATTCTGAATTGAAACCTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004987    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006700.1-2303s1c1
Sequence:CCGGGTCTGTCAGTAACGAGGCTTTCTCGAGAAAGCCTCGTTACTGACAGACTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004988    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006700.1-172s1c1
Sequence:CCGGCCTACCTGTAAGGAACCATTTCTCGAGAAATGGTTCCTTACAGGTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004989    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006700.1-1148s1c1
Sequence:CCGGGCATCATTATCCCATGTGAATCTCGAGATTCACATGGGATAATGATGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000004991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_006700.1-881s1c1
Sequence:CCGGCCAGGTCTCTCAGTGACATAACTCGAGTTATGTCACTGAGAGACCTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279993    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006700.2-1180s21c1
Sequence:CCGGGCATCATTATCCCATGTGAATCTCGAGATTCACATGGGATAATGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000279992    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006700.2-703s21c1
Sequence:CCGGCCCAGGTTTCAATTCAGAATACTCGAGTATTCTGAATTGAAACCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280062    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006700.2-2335s21c1
Sequence:CCGGGTCTGTCAGTAACGAGGCTTTCTCGAGAAAGCCTCGTTACTGACAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000280059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006700.2-913s21c1
Sequence:CCGGCCAGGTCTCTCAGTGACATAACTCGAGTTATGTCACTGAGAGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029574
TRAFD1 MISSION shRNA Bacterial Glycerol Stock
TRAF-type zinc finger domain containing 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000182056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029574.1-1400s1c1
Sequence:CCGGCACCTACTCGATGTCTCCTAACTCGAGTTAGGAGACATCGAGTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029574.1-776s1c1
Sequence:CCGGCGCACACTTGGACTTCATGTTCTCGAGAACATGAAGTCCAAGTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029574.1-1011s1c1
Sequence:CCGGCATGCCTTACGTTCACTCAATCTCGAGATTGAGTGAACGTAAGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029574.1-204s1c1
Sequence:CCGGCCCAAATCTGACATGGACATTCTCGAGAATGTCCATGTCAGATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029574
TRAFD1 MISSION shRNA shRNA Plasmid DNA
TRAF-type zinc finger domain containing 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000182056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029574.1-1400s1c1
Sequence:CCGGCACCTACTCGATGTCTCCTAACTCGAGTTAGGAGACATCGAGTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029574.1-776s1c1
Sequence:CCGGCGCACACTTGGACTTCATGTTCTCGAGAACATGAAGTCCAAGTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029574.1-1011s1c1
Sequence:CCGGCATGCCTTACGTTCACTCAATCTCGAGATTGAGTGAACGTAAGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029574.1-204s1c1
Sequence:CCGGCCCAAATCTGACATGGACATTCTCGAGAATGTCCATGTCAGATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029574
TRAFD1 MISSION shRNA Lentiviral Transduction Particles
TRAF-type zinc finger domain containing 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000182056    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029574.1-1400s1c1
Sequence:CCGGCACCTACTCGATGTCTCCTAACTCGAGTTAGGAGACATCGAGTAGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181475    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029574.1-776s1c1
Sequence:CCGGCGCACACTTGGACTTCATGTTCTCGAGAACATGAAGTCCAAGTGTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197997    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029574.1-1011s1c1
Sequence:CCGGCATGCCTTACGTTCACTCAATCTCGAGATTGAGTGAACGTAAGGCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029574.1-204s1c1
Sequence:CCGGCCCAAATCTGACATGGACATTCTCGAGAATGTCCATGTCAGATTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172275
VALIDATED
TRAFD1 MISSION shRNA Bacterial Glycerol Stock
TRAF-type zinc finger domain containing 1
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000339580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172275.2-1055s21c1
Sequence:CCGGCATGCCTTACGTTCACTCAATCTCGAGATTGAGTGAACGTAAGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172275.2-2226s21c1
Sequence:CCGGCTTGAGTGTGCAGCGTGTTACCTCGAGGTAACACGCTGCACACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172275.2-1444s21c1
Sequence:CCGGCACCTACTCGATGTCTCCTAACTCGAGTTAGGAGACATCGAGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172275.2-820s21c1
Sequence:CCGGCGCACACTTGGACTTCATGTTCTCGAGAACATGAAGTCCAAGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172275
VALIDATED
TRAFD1 MISSION shRNA shRNA Plasmid DNA
TRAF-type zinc finger domain containing 1
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000339580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172275.2-1055s21c1
Sequence:CCGGCATGCCTTACGTTCACTCAATCTCGAGATTGAGTGAACGTAAGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172275.2-2226s21c1
Sequence:CCGGCTTGAGTGTGCAGCGTGTTACCTCGAGGTAACACGCTGCACACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172275.2-1444s21c1
Sequence:CCGGCACCTACTCGATGTCTCCTAACTCGAGTTAGGAGACATCGAGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172275.2-820s21c1
Sequence:CCGGCGCACACTTGGACTTCATGTTCTCGAGAACATGAAGTCCAAGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172275
VALIDATED
TRAFD1 MISSION shRNA Lentiviral Transduction Particles
TRAF-type zinc finger domain containing 1
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000339580    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172275.2-1055s21c1
Sequence:CCGGCATGCCTTACGTTCACTCAATCTCGAGATTGAGTGAACGTAAGGCATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339582    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172275.2-2226s21c1
Sequence:CCGGCTTGAGTGTGCAGCGTGTTACCTCGAGGTAACACGCTGCACACTCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172275.2-1444s21c1
Sequence:CCGGCACCTACTCGATGTCTCCTAACTCGAGTTAGGAGACATCGAGTAGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_172275.2-820s21c1
Sequence:CCGGCGCACACTTGGACTTCATGTTCTCGAGAACATGAAGTCCAAGTGTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks