EMAIL THIS PAGE TO A FRIEND

TRAIP

TRAF interacting protein

Synonyms: RNF206 TRIP
UniProtKB ID: Q9BWF2, O00467
Gene ID:
Human(10293) Summary: This gene encodes a protein that contains an N-terminal RING finger motif and a putative coiled-coil domain. A similar murine protein interacts with TNFR-associated factor 1 (TRAF1), TNFR-associated factor 2 (TRAF2), and cylindromatosis. The interaction with TRAF2 inhibits TRAF2-mediated nuclear factor kappa-B, subunit 1 activation that is required for cell activation and protection against apoptosis. [provided by RefSeq, Jul 2008]
Mouse(22036) TRAF-interacting protein
Rat(367167) TRAF-interacting protein
cow(529769) TRAF interacting protein
sheep(101116685) TRAF interacting protein
domestic guinea pig(100713133) TRAF interacting protein
naked mole-rat(101719854) TRAF interacting protein
Zebrafish(402900) TRAF-interacting protein
chicken(415927) TRAF interacting protein
Horse(100052697) TRAF interacting protein
domestic cat(101089085) TRAF interacting protein
dog(608724) TRAF interacting protein
92 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_011634 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011634 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011634 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_005879 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_005879 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_005879 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU044871 MISSION® esiRNA esiRNA human TRAIP (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_005879 Rosetta Predictions human pricing
NM_001109004 Rosetta Predictions rat pricing
NM_011634 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_005879 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00138374 predicted 696
2 SASI_Hs01_00138376 predicted 1035
3 SASI_Hs01_00138377 predicted 265
4 SASI_Hs01_00138378 predicted 318
5 SASI_Hs01_00138379 predicted 1551
6 SASI_Hs01_00138380 predicted 908
7 SASI_Hs01_00138381 predicted 866
8 SASI_Hs01_00138382 predicted 824
9 SASI_Hs01_00138383 predicted 1393
10 SASI_Hs02_00340468 predicted 657
11 SASI_Hs01_00138375 predicted 1425
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109004 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244224 predicted 1014
2 SASI_Rn02_00244225 predicted 1325
3 SASI_Rn02_00244226 predicted 1474
4 SASI_Rn02_00244227 predicted 858
5 SASI_Rn02_00244228 predicted 296
6 SASI_Rn02_00244229 predicted 1467
7 SASI_Rn02_00244230 predicted 1016
8 SASI_Rn02_00244231 predicted 1503
9 SASI_Rn02_00244232 predicted 754
10 SASI_Rn02_00244233 predicted 1557
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011634 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198772 predicted 1355
2 SASI_Mm01_00198763 predicted 920
3 SASI_Mm01_00198764 predicted 320
4 SASI_Mm02_00321083 predicted 1449
5 SASI_Mm02_00321084 predicted 1426
6 SASI_Mm01_00198765 predicted 891
7 SASI_Mm01_00198766 predicted 328
8 SASI_Mm02_00321085 predicted 1502
9 SASI_Mm01_00198767 predicted 1039
10 SASI_Mm01_00198768 predicted 1536
11 SASI_Mm01_00198769 predicted 476
12 SASI_Mm01_00198770 predicted 1055
13 SASI_Mm01_00198771 predicted 304
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011634
VALIDATED
TRAIP MISSION shRNA Bacterial Glycerol Stock
TRAF interacting protein
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000316540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011634.3-715s21c1
Sequence:CCGGCGTGTCCCTCAAGAAAGAGTACTCGAGTACTCTTTCTTGAGGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011634.3-1269s21c1
Sequence:CCGGTCCCTCTCTTCATCCGGAATGCTCGAGCATTCCGGATGAAGAGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011634.3-896s21c1
Sequence:CCGGCAGGAGATCACGAGCCTAAGACTCGAGTCTTAGGCTCGTGATCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011634.3-1347s21c1
Sequence:CCGGATGTGGTAAGAATAGGCTTTGCTCGAGCAAAGCCTATTCTTACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304882    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011634.3-1774s21c1
Sequence:CCGGTTATAGAACAGGGTCACATTGCTCGAGCAATGTGACCCTGTTCTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011634.2-2369s1c1
Sequence:CCGGGCCTTCTTTAAGTGATGCTTACTCGAGTAAGCATCACTTAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011634.2-714s1c1
Sequence:CCGGCGTGTCCCTCAAGAAAGAGTACTCGAGTACTCTTTCTTGAGGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011634.2-1044s1c1
Sequence:CCGGCGGTGATGAGATTGATCTCAACTCGAGTTGAGATCAATCTCATCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011634.2-1496s1c1
Sequence:CCGGCCAAGCTGGATACCTTCTTATCTCGAGATAAGAAGGTATCCAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011634.2-544s1c1
Sequence:CCGGCGGCAGGATGAGACCAAACAACTCGAGTTGTTTGGTCTCATCCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011634
VALIDATED
TRAIP MISSION shRNA shRNA Plasmid DNA
TRAF interacting protein
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000316540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011634.3-715s21c1
Sequence:CCGGCGTGTCCCTCAAGAAAGAGTACTCGAGTACTCTTTCTTGAGGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011634.3-1269s21c1
Sequence:CCGGTCCCTCTCTTCATCCGGAATGCTCGAGCATTCCGGATGAAGAGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011634.3-896s21c1
Sequence:CCGGCAGGAGATCACGAGCCTAAGACTCGAGTCTTAGGCTCGTGATCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011634.3-1347s21c1
Sequence:CCGGATGTGGTAAGAATAGGCTTTGCTCGAGCAAAGCCTATTCTTACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304882    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011634.3-1774s21c1
Sequence:CCGGTTATAGAACAGGGTCACATTGCTCGAGCAATGTGACCCTGTTCTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011634.2-2369s1c1
Sequence:CCGGGCCTTCTTTAAGTGATGCTTACTCGAGTAAGCATCACTTAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011634.2-714s1c1
Sequence:CCGGCGTGTCCCTCAAGAAAGAGTACTCGAGTACTCTTTCTTGAGGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011634.2-1044s1c1
Sequence:CCGGCGGTGATGAGATTGATCTCAACTCGAGTTGAGATCAATCTCATCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011634.2-1496s1c1
Sequence:CCGGCCAAGCTGGATACCTTCTTATCTCGAGATAAGAAGGTATCCAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011634.2-544s1c1
Sequence:CCGGCGGCAGGATGAGACCAAACAACTCGAGTTGTTTGGTCTCATCCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011634
VALIDATED
TRAIP MISSION shRNA Lentiviral Transduction Particles
TRAF interacting protein
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000316540    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011634.3-715s21c1
Sequence:CCGGCGTGTCCCTCAAGAAAGAGTACTCGAGTACTCTTTCTTGAGGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304824    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011634.3-1269s21c1
Sequence:CCGGTCCCTCTCTTCATCCGGAATGCTCGAGCATTCCGGATGAAGAGAGGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304822    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011634.3-896s21c1
Sequence:CCGGCAGGAGATCACGAGCCTAAGACTCGAGTCTTAGGCTCGTGATCTCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011634.3-1347s21c1
Sequence:CCGGATGTGGTAAGAATAGGCTTTGCTCGAGCAAAGCCTATTCTTACCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304882    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011634.3-1774s21c1
Sequence:CCGGTTATAGAACAGGGTCACATTGCTCGAGCAATGTGACCCTGTTCTATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040748    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011634.2-2369s1c1
Sequence:CCGGGCCTTCTTTAAGTGATGCTTACTCGAGTAAGCATCACTTAAAGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040752    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011634.2-714s1c1
Sequence:CCGGCGTGTCCCTCAAGAAAGAGTACTCGAGTACTCTTTCTTGAGGGACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040749    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011634.2-1044s1c1
Sequence:CCGGCGGTGATGAGATTGATCTCAACTCGAGTTGAGATCAATCTCATCACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040750    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011634.2-1496s1c1
Sequence:CCGGCCAAGCTGGATACCTTCTTATCTCGAGATAAGAAGGTATCCAGCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040751    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011634.2-544s1c1
Sequence:CCGGCGGCAGGATGAGACCAAACAACTCGAGTTGTTTGGTCTCATCCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_005879
VALIDATED
TRAIP MISSION shRNA Bacterial Glycerol Stock
TRAF interacting protein
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000291847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005879.2-1036s21c1
Sequence:CCGGCCGTGATGATATTGATCTCAACTCGAGTTGAGATCAATATCATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005879.2-199s21c1
Sequence:CCGGGCAGTGCCTAATTCAGTGGTTCTCGAGAACCACTGAATTAGGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005879.2-1101s21c1
Sequence:CCGGCCCAGCATGGTTACTACGAAACTCGAGTTTCGTAGTAACCATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005879.2-814s21c1
Sequence:CCGGGCAGACAGTCTACTCTGAATTCTCGAGAATTCAGAGTAGACTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005879.2-1390s1c1
Sequence:CCGGGCCTACTGACACAGTCATGATCTCGAGATCATGACTGTGTCAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005879.2-814s1c1
Sequence:CCGGGCAGACAGTCTACTCTGAATTCTCGAGAATTCAGAGTAGACTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005879.2-1036s1c1
Sequence:CCGGCCGTGATGATATTGATCTCAACTCGAGTTGAGATCAATATCATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005879.2-1101s1c1
Sequence:CCGGCCCAGCATGGTTACTACGAAACTCGAGTTTCGTAGTAACCATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000033741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005879.2-199s1c1
Sequence:CCGGGCAGTGCCTAATTCAGTGGTTCTCGAGAACCACTGAATTAGGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_005879
VALIDATED
TRAIP MISSION shRNA shRNA Plasmid DNA
TRAF interacting protein
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000291847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005879.2-1036s21c1
Sequence:CCGGCCGTGATGATATTGATCTCAACTCGAGTTGAGATCAATATCATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005879.2-199s21c1
Sequence:CCGGGCAGTGCCTAATTCAGTGGTTCTCGAGAACCACTGAATTAGGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005879.2-1101s21c1
Sequence:CCGGCCCAGCATGGTTACTACGAAACTCGAGTTTCGTAGTAACCATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005879.2-814s21c1
Sequence:CCGGGCAGACAGTCTACTCTGAATTCTCGAGAATTCAGAGTAGACTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005879.2-1390s1c1
Sequence:CCGGGCCTACTGACACAGTCATGATCTCGAGATCATGACTGTGTCAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005879.2-814s1c1
Sequence:CCGGGCAGACAGTCTACTCTGAATTCTCGAGAATTCAGAGTAGACTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005879.2-1036s1c1
Sequence:CCGGCCGTGATGATATTGATCTCAACTCGAGTTGAGATCAATATCATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005879.2-1101s1c1
Sequence:CCGGCCCAGCATGGTTACTACGAAACTCGAGTTTCGTAGTAACCATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000033741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005879.2-199s1c1
Sequence:CCGGGCAGTGCCTAATTCAGTGGTTCTCGAGAACCACTGAATTAGGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_005879
VALIDATED
TRAIP MISSION shRNA Lentiviral Transduction Particles
TRAF interacting protein
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000291847    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005879.2-1036s21c1
Sequence:CCGGCCGTGATGATATTGATCTCAACTCGAGTTGAGATCAATATCATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291849    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005879.2-199s21c1
Sequence:CCGGGCAGTGCCTAATTCAGTGGTTCTCGAGAACCACTGAATTAGGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291848    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005879.2-1101s21c1
Sequence:CCGGCCCAGCATGGTTACTACGAAACTCGAGTTTCGTAGTAACCATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291846    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_005879.2-814s21c1
Sequence:CCGGGCAGACAGTCTACTCTGAATTCTCGAGAATTCAGAGTAGACTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033742    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005879.2-1390s1c1
Sequence:CCGGGCCTACTGACACAGTCATGATCTCGAGATCATGACTGTGTCAGTAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033743    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005879.2-814s1c1
Sequence:CCGGGCAGACAGTCTACTCTGAATTCTCGAGAATTCAGAGTAGACTGTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033739    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005879.2-1036s1c1
Sequence:CCGGCCGTGATGATATTGATCTCAACTCGAGTTGAGATCAATATCATCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033740    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005879.2-1101s1c1
Sequence:CCGGCCCAGCATGGTTACTACGAAACTCGAGTTTCGTAGTAACCATGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000033741    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_005879.2-199s1c1
Sequence:CCGGGCAGTGCCTAATTCAGTGGTTCTCGAGAACCACTGAATTAGGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks