EMAIL THIS PAGE TO A FRIEND

TRAK1

trafficking protein, kinesin binding 1

Synonyms: MILT1 OIP106
UniProtKB ID: Q9UPV9, E9PDS2, Q63HR0, Q659B5, Q96B69
Gene ID:
Mouse(67095) trafficking protein, kinesin binding 1
Rat(316085) trafficking protein, kinesin binding 1
cow(531649) trafficking protein, kinesin binding 1
sheep(101115912) trafficking protein, kinesin binding 1
naked mole-rat(101720212) trafficking protein, kinesin binding 1
domestic guinea pig(100734750) trafficking protein, kinesin binding 1
Zebrafish(100002689) trafficking protein, kinesin binding 1
Horse(100067628) trafficking protein, kinesin binding 1
domestic cat(101097090) trafficking protein, kinesin binding 1
dog(485610) trafficking protein, kinesin binding 1
chicken(100857812) trafficking protein, kinesin binding 1
chicken(420714) trafficking protein, kinesin binding 1
111 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014965 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014965 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014965 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_175114 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175114 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175114 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042646 Rosetta Predictions human pricing
NM_014965 Rosetta Predictions human pricing
NM_001134565 Rosetta Predictions rat pricing
NM_175114 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042646 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00310873 predicted 1600
2 SASI_Hs02_00310874 predicted 1579
3 SASI_Hs02_00310875 predicted 1246
4 SASI_Hs02_00310876 predicted 1636
5 SASI_Hs02_00310877 predicted 1927
6 SASI_Hs02_00310878 predicted 1947
7 SASI_Hs02_00310879 predicted 1604
8 SASI_Hs02_00310880 predicted 1215
9 SASI_Hs02_00310881 predicted 989
10 SASI_Hs02_00310882 predicted 798
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346661 predicted 1404
2 SASI_Hs02_00346662 predicted 1374
3 SASI_Hs01_00211811 predicted 1051
4 SASI_Hs01_00211813 predicted 1445
5 SASI_Hs01_00211817 predicted 1730
6 SASI_Hs02_00346663 predicted 1758
7 SASI_Hs02_00346664 predicted 1404
8 SASI_Hs02_00346665 predicted 1012
9 SASI_Hs01_00211819 predicted 794
10 SASI_Hs02_00346666 predicted 609
11 SASI_Hs01_00211812 predicted 629
12 SASI_Hs01_00211814 predicted 674
13 SASI_Hs01_00211815 predicted 376
14 SASI_Hs01_00211816 predicted 324
15 SASI_Hs01_00211818 predicted 1220
16 SASI_Hs01_00211820 predicted 1864
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001134565 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00257139 predicted 273
2 SASI_Rn02_00257140 predicted 1906
3 SASI_Rn02_00257141 predicted 855
4 SASI_Rn02_00257142 predicted 670
5 SASI_Rn02_00257143 predicted 882
6 SASI_Rn02_00257144 predicted 1474
7 SASI_Rn02_00257145 predicted 1328
8 SASI_Rn02_00257146 predicted 290
9 SASI_Rn02_00257147 predicted 1997
10 SASI_Rn02_00257148 predicted 1516
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175114 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00101496 predicted 462
2 SASI_Mm01_00101497 predicted 629
3 SASI_Mm01_00101498 predicted 425
4 SASI_Mm02_00345724 predicted 2055
5 SASI_Mm01_00101500 predicted 315
6 SASI_Mm02_00345725 predicted 2131
7 SASI_Mm01_00101502 predicted 1006
8 SASI_Mm02_00345726 predicted 1897
9 SASI_Mm01_00101504 predicted 307
10 SASI_Mm02_00345727 predicted 2141
11 SASI_Mm01_00101499 predicted 786
12 SASI_Mm01_00101501 predicted 2497
13 SASI_Mm01_00101503 predicted 1999
14 SASI_Mm01_00101505 predicted 2435
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014965
VALIDATED
TRAK1 MISSION shRNA Bacterial Glycerol Stock
trafficking protein, kinesin binding 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000036274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014965.2-2123s1c1
Sequence:CCGGGCACCACGATAAGTCCTGTAACTCGAGTTACAGGACTTATCGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014965.2-876s1c1
Sequence:CCGGGCTATCGCAAATAGTTGATTTCTCGAGAAATCAACTATTTGCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014965.2-623s1c1
Sequence:CCGGCAGTCCAGAATTACTTTCATTCTCGAGAATGAAAGTAATTCTGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014965.2-1392s1c1
Sequence:CCGGCGACAACAAGACCAACAGCATCTCGAGATGCTGTTGGTCTTGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000036275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014965.2-324s1c1
Sequence:CCGGCCAGATGACTAAGACATATAACTCGAGTTATATGTCTTAGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014965.3-328s21c1
Sequence:CCGGCCAGATGACTAAGACATATAACTCGAGTTATATGTCTTAGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014965.3-880s21c1
Sequence:CCGGGCTATCGCAAATAGTTGATTTCTCGAGAAATCAACTATTTGCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014965.3-1396s21c1
Sequence:CCGGCGACAACAAGACCAACAGCATCTCGAGATGCTGTTGGTCTTGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000294179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014965.3-1884s21c1
Sequence:CCGGTGTACTGCCTTAACGACTTTGCTCGAGCAAAGTCGTTAAGGCAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000306921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014965.3-2357s21c1
Sequence:CCGGATGGCCCATCAGGGATCTTTACTCGAGTAAAGATCCCTGATGGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014965
VALIDATED
TRAK1 MISSION shRNA shRNA Plasmid DNA
trafficking protein, kinesin binding 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000036274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014965.2-2123s1c1
Sequence:CCGGGCACCACGATAAGTCCTGTAACTCGAGTTACAGGACTTATCGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014965.2-876s1c1
Sequence:CCGGGCTATCGCAAATAGTTGATTTCTCGAGAAATCAACTATTTGCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014965.2-623s1c1
Sequence:CCGGCAGTCCAGAATTACTTTCATTCTCGAGAATGAAAGTAATTCTGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014965.2-1392s1c1
Sequence:CCGGCGACAACAAGACCAACAGCATCTCGAGATGCTGTTGGTCTTGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000036275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014965.2-324s1c1
Sequence:CCGGCCAGATGACTAAGACATATAACTCGAGTTATATGTCTTAGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014965.3-328s21c1
Sequence:CCGGCCAGATGACTAAGACATATAACTCGAGTTATATGTCTTAGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014965.3-880s21c1
Sequence:CCGGGCTATCGCAAATAGTTGATTTCTCGAGAAATCAACTATTTGCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014965.3-1396s21c1
Sequence:CCGGCGACAACAAGACCAACAGCATCTCGAGATGCTGTTGGTCTTGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000294179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014965.3-1884s21c1
Sequence:CCGGTGTACTGCCTTAACGACTTTGCTCGAGCAAAGTCGTTAAGGCAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000306921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014965.3-2357s21c1
Sequence:CCGGATGGCCCATCAGGGATCTTTACTCGAGTAAAGATCCCTGATGGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014965
VALIDATED
TRAK1 MISSION shRNA Lentiviral Transduction Particles
trafficking protein, kinesin binding 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000036274    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014965.2-2123s1c1
Sequence:CCGGGCACCACGATAAGTCCTGTAACTCGAGTTACAGGACTTATCGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036276    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014965.2-876s1c1
Sequence:CCGGGCTATCGCAAATAGTTGATTTCTCGAGAAATCAACTATTTGCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036278    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014965.2-623s1c1
Sequence:CCGGCAGTCCAGAATTACTTTCATTCTCGAGAATGAAAGTAATTCTGGACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036277    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014965.2-1392s1c1
Sequence:CCGGCGACAACAAGACCAACAGCATCTCGAGATGCTGTTGGTCTTGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000036275    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014965.2-324s1c1
Sequence:CCGGCCAGATGACTAAGACATATAACTCGAGTTATATGTCTTAGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286856    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014965.3-328s21c1
Sequence:CCGGCCAGATGACTAAGACATATAACTCGAGTTATATGTCTTAGTCATCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286855    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014965.3-880s21c1
Sequence:CCGGGCTATCGCAAATAGTTGATTTCTCGAGAAATCAACTATTTGCGATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286901    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014965.3-1396s21c1
Sequence:CCGGCGACAACAAGACCAACAGCATCTCGAGATGCTGTTGGTCTTGTTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000294179    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014965.3-1884s21c1
Sequence:CCGGTGTACTGCCTTAACGACTTTGCTCGAGCAAAGTCGTTAAGGCAGTACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000306921    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014965.3-2357s21c1
Sequence:CCGGATGGCCCATCAGGGATCTTTACTCGAGTAAAGATCCCTGATGGGCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175114
TRAK1 MISSION shRNA Bacterial Glycerol Stock
trafficking protein, kinesin binding 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175114.2-3216s1c1
Sequence:CCGGCCGTGCTTATAGAGAGCAAATCTCGAGATTTGCTCTCTATAAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175114.2-907s1c1
Sequence:CCGGCGGTCAGTCATTGTTGAAGAACTCGAGTTCTTCAACAATGACTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175114.2-2332s1c1
Sequence:CCGGCCAGTGTCACACCTATTCATTCTCGAGAATGAATAGGTGTGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175114.2-783s1c1
Sequence:CCGGCGCTGAAATACTTCCTTCTATCTCGAGATAGAAGGAAGTATTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175114.2-2333s1c1
Sequence:CCGGCAGTGTCACACCTATTCATTTCTCGAGAAATGAATAGGTGTGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000442834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175114.3-3196s21c1
Sequence:CCGGGATGTCACCTGAGCTCATTTGCTCGAGCAAATGAGCTCAGGTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175114.3-3149s21c1
Sequence:CCGGTCCAATCCACAGGAAGTAATACTCGAGTATTACTTCCTGTGGATTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175114.3-2002s21c1
Sequence:CCGGTGTACTGCCTTAACGACTTTGCTCGAGCAAAGTCGTTAAGGCAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175114.3-1348s21c1
Sequence:CCGGAGACGGTGAGGAACGTCAATCCTCGAGGATTGACGTTCCTCACCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175114
TRAK1 MISSION shRNA shRNA Plasmid DNA
trafficking protein, kinesin binding 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175114.2-3216s1c1
Sequence:CCGGCCGTGCTTATAGAGAGCAAATCTCGAGATTTGCTCTCTATAAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175114.2-907s1c1
Sequence:CCGGCGGTCAGTCATTGTTGAAGAACTCGAGTTCTTCAACAATGACTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175114.2-2332s1c1
Sequence:CCGGCCAGTGTCACACCTATTCATTCTCGAGAATGAATAGGTGTGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175114.2-783s1c1
Sequence:CCGGCGCTGAAATACTTCCTTCTATCTCGAGATAGAAGGAAGTATTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175114.2-2333s1c1
Sequence:CCGGCAGTGTCACACCTATTCATTTCTCGAGAAATGAATAGGTGTGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000442834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175114.3-3196s21c1
Sequence:CCGGGATGTCACCTGAGCTCATTTGCTCGAGCAAATGAGCTCAGGTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175114.3-3149s21c1
Sequence:CCGGTCCAATCCACAGGAAGTAATACTCGAGTATTACTTCCTGTGGATTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175114.3-2002s21c1
Sequence:CCGGTGTACTGCCTTAACGACTTTGCTCGAGCAAAGTCGTTAAGGCAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175114.3-1348s21c1
Sequence:CCGGAGACGGTGAGGAACGTCAATCCTCGAGGATTGACGTTCCTCACCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175114
TRAK1 MISSION shRNA Lentiviral Transduction Particles
trafficking protein, kinesin binding 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_175114.2-3216s1c1
Sequence:CCGGCCGTGCTTATAGAGAGCAAATCTCGAGATTTGCTCTCTATAAGCACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175114.2-907s1c1
Sequence:CCGGCGGTCAGTCATTGTTGAAGAACTCGAGTTCTTCAACAATGACTGACCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175114.2-2332s1c1
Sequence:CCGGCCAGTGTCACACCTATTCATTCTCGAGAATGAATAGGTGTGACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175114.2-783s1c1
Sequence:CCGGCGCTGAAATACTTCCTTCTATCTCGAGATAGAAGGAAGTATTTCAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175114.2-2333s1c1
Sequence:CCGGCAGTGTCACACCTATTCATTTCTCGAGAAATGAATAGGTGTGACACTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000442834    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175114.3-3196s21c1
Sequence:CCGGGATGTCACCTGAGCTCATTTGCTCGAGCAAATGAGCTCAGGTGACATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414662    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175114.3-3149s21c1
Sequence:CCGGTCCAATCCACAGGAAGTAATACTCGAGTATTACTTCCTGTGGATTGGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175114.3-2002s21c1
Sequence:CCGGTGTACTGCCTTAACGACTTTGCTCGAGCAAAGTCGTTAAGGCAGTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425028    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175114.3-1348s21c1
Sequence:CCGGAGACGGTGAGGAACGTCAATCCTCGAGGATTGACGTTCCTCACCGTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks