EMAIL THIS PAGE TO A FRIEND

TRAK2

trafficking protein, kinesin binding 2

Synonyms: ALS2CR3 CALS-C GRIF-1 GRIF1 MILT2 OIP98
UniProtKB ID: O60296, Q8WVH7, Q96NS2, Q9C0K5, Q9C0K6
Gene ID:
Mouse(70827) trafficking protein, kinesin binding 2
Rat(171086) trafficking protein, kinesin binding 2
Zebrafish(560810) trafficking protein, kinesin binding 2
Horse(100066224) trafficking protein, kinesin binding 2
domestic cat(101094365) trafficking protein, kinesin binding 2
dog(488475) trafficking protein, kinesin binding 2
chicken(424082) trafficking protein, kinesin binding 2
domestic guinea pig(100713062) trafficking protein, kinesin binding 2
naked mole-rat(101701518) trafficking protein, kinesin binding 2
cow(523970) trafficking protein, kinesin binding 2
sheep(101108286) trafficking protein, kinesin binding 2
149 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_015049 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_015049 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_015049 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172406 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172406 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172406 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_015049 Rosetta Predictions human pricing
NM_133560 Rosetta Predictions rat pricing
NM_172406 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_015049 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025697 predicted 1192
2 SASI_Hs01_00025698 predicted 1407
3 SASI_Hs01_00025699 predicted 1033
4 SASI_Hs02_00346892 predicted 892
5 SASI_Hs01_00025701 predicted 1519
6 SASI_Hs01_00025702 predicted 3085
7 SASI_Hs01_00025704 predicted 589
8 SASI_Hs01_00025705 predicted 962
9 SASI_Hs02_00346893 predicted 1695
10 SASI_Hs02_00346894 predicted 701
11 SASI_Hs01_00025700 predicted 1841
12 SASI_Hs01_00025703 predicted 1383
13 SASI_Hs01_00025706 predicted 2222
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133560 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00064019 predicted 1536
2 SASI_Rn01_00064020 predicted 533
3 SASI_Rn02_00267754 predicted 1654
4 SASI_Rn01_00064022 predicted 3019
5 SASI_Rn01_00064023 predicted 522
6 SASI_Rn01_00064024 predicted 1522
7 SASI_Rn01_00064025 predicted 1120
8 SASI_Rn01_00064026 predicted 2884
9 SASI_Rn02_00267755 predicted 1839
10 SASI_Rn01_00064027 predicted 2171
11 SASI_Rn01_00064021 predicted 694
12 SASI_Rn01_00064028 predicted 791
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00048103 predicted 200
2 SASI_Mm01_00048104 predicted 1326
3 SASI_Mm01_00048105 predicted 2885
4 SASI_Mm01_00048106 predicted 1446
5 SASI_Mm01_00048107 predicted 2904
6 SASI_Mm01_00048108 predicted 572
7 SASI_Mm01_00048109 predicted 2308
8 SASI_Mm02_00343869 predicted 2812
9 SASI_Mm01_00048110 predicted 1626
10 SASI_Mm01_00048112 predicted 626
11 SASI_Mm01_00048111 predicted 2149
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_015049
VALIDATED
TRAK2 MISSION shRNA Bacterial Glycerol Stock
trafficking protein, kinesin binding 2
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000297060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015049.2-5393s21c1
Sequence:CCGGCGTGCTCTGTATTGAGTATAACTCGAGTTATACTCAATACAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015049.2-1427s21c1
Sequence:CCGGCGAGTTACAAGACAGGAATATCTCGAGATATTCCTGTCTTGTAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000297061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015049.2-5056s21c1
Sequence:CCGGCCAGCAGGTTTATATGTGAATCTCGAGATTCACATATAAACCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015049.2-3079s21c1
Sequence:CCGGGCAGTTTATTAGGTGGACTAACTCGAGTTAGTCCACCTAATAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015049.1-4815s1c1
Sequence:CCGGGCCAACATGAATGCAGTGGTACTCGAGTACCACTGCATTCATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015049.1-1362s1c1
Sequence:CCGGCGAGTTACAAGACAGGAATATCTCGAGATATTCCTGTCTTGTAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015049.1-4990s1c1
Sequence:CCGGCCAGCAGGTTTATATGTGAATCTCGAGATTCACATATAAACCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152107    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015049.1-5327s1c1
Sequence:CCGGCGTGCTCTGTATTGAGTATAACTCGAGTTATACTCAATACAGAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015049.1-969s1c1
Sequence:CCGGGTTCAATGAGTCCTTTAGCTTCTCGAGAAGCTAAAGGACTCATTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015049.1-523s1c1
Sequence:CCGGGAAGAACAACTACCACAGTATCTCGAGATACTGTGGTAGTTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015049.1-3014s1c1
Sequence:CCGGGCAGTTTATTAGGTGGACTAACTCGAGTTAGTCCACCTAATAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015049.1-1072s1c1
Sequence:CCGGGCTTGTCACATAAAGACAGAACTCGAGTTCTGTCTTTATGTGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_015049
VALIDATED
TRAK2 MISSION shRNA shRNA Plasmid DNA
trafficking protein, kinesin binding 2
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000297060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015049.2-5393s21c1
Sequence:CCGGCGTGCTCTGTATTGAGTATAACTCGAGTTATACTCAATACAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015049.2-1427s21c1
Sequence:CCGGCGAGTTACAAGACAGGAATATCTCGAGATATTCCTGTCTTGTAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000297061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015049.2-5056s21c1
Sequence:CCGGCCAGCAGGTTTATATGTGAATCTCGAGATTCACATATAAACCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015049.2-3079s21c1
Sequence:CCGGGCAGTTTATTAGGTGGACTAACTCGAGTTAGTCCACCTAATAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015049.1-4815s1c1
Sequence:CCGGGCCAACATGAATGCAGTGGTACTCGAGTACCACTGCATTCATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015049.1-1362s1c1
Sequence:CCGGCGAGTTACAAGACAGGAATATCTCGAGATATTCCTGTCTTGTAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015049.1-4990s1c1
Sequence:CCGGCCAGCAGGTTTATATGTGAATCTCGAGATTCACATATAAACCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152107    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015049.1-5327s1c1
Sequence:CCGGCGTGCTCTGTATTGAGTATAACTCGAGTTATACTCAATACAGAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015049.1-969s1c1
Sequence:CCGGGTTCAATGAGTCCTTTAGCTTCTCGAGAAGCTAAAGGACTCATTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015049.1-523s1c1
Sequence:CCGGGAAGAACAACTACCACAGTATCTCGAGATACTGTGGTAGTTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015049.1-3014s1c1
Sequence:CCGGGCAGTTTATTAGGTGGACTAACTCGAGTTAGTCCACCTAATAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015049.1-1072s1c1
Sequence:CCGGGCTTGTCACATAAAGACAGAACTCGAGTTCTGTCTTTATGTGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_015049
VALIDATED
TRAK2 MISSION shRNA Lentiviral Transduction Particles
trafficking protein, kinesin binding 2
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000297060    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015049.2-5393s21c1
Sequence:CCGGCGTGCTCTGTATTGAGTATAACTCGAGTTATACTCAATACAGAGCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286055    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015049.2-1427s21c1
Sequence:CCGGCGAGTTACAAGACAGGAATATCTCGAGATATTCCTGTCTTGTAACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000297061    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_015049.2-5056s21c1
Sequence:CCGGCCAGCAGGTTTATATGTGAATCTCGAGATTCACATATAAACCTGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277896    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_015049.2-3079s21c1
Sequence:CCGGGCAGTTTATTAGGTGGACTAACTCGAGTTAGTCCACCTAATAAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154743    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.82 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015049.1-4815s1c1
Sequence:CCGGGCCAACATGAATGCAGTGGTACTCGAGTACCACTGCATTCATGTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151696    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015049.1-1362s1c1
Sequence:CCGGCGAGTTACAAGACAGGAATATCTCGAGATATTCCTGTCTTGTAACTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151916    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015049.1-4990s1c1
Sequence:CCGGCCAGCAGGTTTATATGTGAATCTCGAGATTCACATATAAACCTGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152107    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015049.1-5327s1c1
Sequence:CCGGCGTGCTCTGTATTGAGTATAACTCGAGTTATACTCAATACAGAGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151623    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015049.1-969s1c1
Sequence:CCGGGTTCAATGAGTCCTTTAGCTTCTCGAGAAGCTAAAGGACTCATTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151380    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015049.1-523s1c1
Sequence:CCGGGAAGAACAACTACCACAGTATCTCGAGATACTGTGGTAGTTGTTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151302    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_015049.1-3014s1c1
Sequence:CCGGGCAGTTTATTAGGTGGACTAACTCGAGTTAGTCCACCTAATAAACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151434    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_015049.1-1072s1c1
Sequence:CCGGGCTTGTCACATAAAGACAGAACTCGAGTTCTGTCTTTATGTGACAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172406
VALIDATED
TRAK2 MISSION shRNA Bacterial Glycerol Stock
trafficking protein, kinesin binding 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000119392    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172406.2-3499s1c1
Sequence:CCGGCCCAGATAGATTCCTTGGTATCTCGAGATACCAAGGAATCTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172406.2-315s1c1
Sequence:CCGGCCACAGTATAAGCTAAGAGTACTCGAGTACTCTTAGCTTATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172406.2-2028s1c1
Sequence:CCGGCCTCTTCAACTGGAGCAGAAACTCGAGTTTCTGCTCCAGTTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172406.2-852s1c1
Sequence:CCGGGCTTGTCATATCAAGACAGAACTCGAGTTCTGTCTTGATATGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000119395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172406.2-2591s1c1
Sequence:CCGGCCTGCAAGAAATGTATGGCTTCTCGAGAAGCCATACATTTCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172406
VALIDATED
TRAK2 MISSION shRNA shRNA Plasmid DNA
trafficking protein, kinesin binding 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000119392    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172406.2-3499s1c1
Sequence:CCGGCCCAGATAGATTCCTTGGTATCTCGAGATACCAAGGAATCTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172406.2-315s1c1
Sequence:CCGGCCACAGTATAAGCTAAGAGTACTCGAGTACTCTTAGCTTATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172406.2-2028s1c1
Sequence:CCGGCCTCTTCAACTGGAGCAGAAACTCGAGTTTCTGCTCCAGTTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172406.2-852s1c1
Sequence:CCGGGCTTGTCATATCAAGACAGAACTCGAGTTCTGTCTTGATATGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000119395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172406.2-2591s1c1
Sequence:CCGGCCTGCAAGAAATGTATGGCTTCTCGAGAAGCCATACATTTCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172406
VALIDATED
TRAK2 MISSION shRNA Lentiviral Transduction Particles
trafficking protein, kinesin binding 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000119392    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172406.2-3499s1c1
Sequence:CCGGCCCAGATAGATTCCTTGGTATCTCGAGATACCAAGGAATCTATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119393    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172406.2-315s1c1
Sequence:CCGGCCACAGTATAAGCTAAGAGTACTCGAGTACTCTTAGCTTATACTGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119394    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172406.2-2028s1c1
Sequence:CCGGCCTCTTCAACTGGAGCAGAAACTCGAGTTTCTGCTCCAGTTGAAGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119396    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_172406.2-852s1c1
Sequence:CCGGGCTTGTCATATCAAGACAGAACTCGAGTTCTGTCTTGATATGACAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000119395    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172406.2-2591s1c1
Sequence:CCGGCCTGCAAGAAATGTATGGCTTCTCGAGAAGCCATACATTTCTTGCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks