EMAIL THIS PAGE TO A FRIEND

TRAM1

translocation associated membrane protein 1

Synonyms: PNAS8 TRAM TRAMP
UniProtKB ID: Q15629
Gene ID:
Human(23471) Summary: This gene encodes a multi-pass membrane protein that is part of the mammalian endoplasmic reticulum. The encoded protein influences glycosylation and facilitates the translocation of secretory proteins across the endoplasmic reticulum membrane by regulating which domains of the nascent polypeptide chain are visible to the cytosol during a translocational pause. [provided by RefSeq, Oct 2009]
Mouse(72265) translocating chain-associating membrane protein 1
Rat(312903) translocation associated membrane protein 1
Zebrafish(266757) translocating chain-associating membrane protein 1
chicken(378918) translocation associated membrane protein 1
domestic cat(101097373) translocation associated membrane protein 1
dog(403948) translocation associated membrane protein 1
cow(281546) translocation associated membrane protein 1
sheep(101104503) translocation associated membrane protein 1
Domestic Rabbit(100347726) translocation associated membrane protein 1
domestic guinea pig(100735155) translocation associated membrane protein 1
150 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_028173 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_028173 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_028173 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014294 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014294 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014294 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014294 Rosetta Predictions human pricing
NM_001007701 Rosetta Predictions rat pricing
XM_001064383 Rosetta Predictions rat pricing
NM_028173 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014294 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00172776 predicted 423
2 SASI_Hs01_00172777 predicted 573
3 SASI_Hs01_00172778 predicted 1295
4 SASI_Hs01_00172779 predicted 434
5 SASI_Hs01_00172780 predicted 615
6 SASI_Hs01_00172781 predicted 1229
7 SASI_Hs01_00172782 predicted 823
8 SASI_Hs01_00172783 predicted 1072
9 SASI_Hs01_00172784 predicted 1187
10 SASI_Hs01_00172785 predicted 360
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001007701 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00030853 predicted 416
2 SASI_Rn02_00198861 predicted 947
3 SASI_Rn01_00030854 predicted 781
4 SASI_Rn01_00030855 predicted 357
5 SASI_Rn01_00030856 predicted 826
6 SASI_Rn01_00030858 predicted 1268
7 SASI_Rn01_00030859 predicted 675
8 SASI_Rn01_00030861 predicted 440
9 SASI_Rn01_00030862 predicted 366
10 SASI_Rn02_00198862 predicted 1285
11 SASI_Rn01_00030857 predicted 851
12 SASI_Rn01_00030860 predicted 377
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001064383 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00310246 predicted 307
2 SASI_Rn02_00310247 predicted 824
3 SASI_Rn02_00310248 predicted 663
4 SASI_Rn02_00310249 predicted 235
5 SASI_Rn02_00310250 predicted 704
6 SASI_Rn02_00310251 predicted 728
7 SASI_Rn02_00310252 predicted 550
8 SASI_Rn02_00310253 predicted 330
9 SASI_Rn02_00310254 predicted 248
10 SASI_Rn02_00310255 predicted 820
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_028173 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00127547 predicted 347
2 SASI_Mm01_00127548 predicted 808
3 SASI_Mm02_00333439 predicted 836
4 SASI_Mm01_00127549 predicted 405
5 SASI_Mm01_00127551 predicted 360
6 SASI_Mm01_00127552 predicted 431
7 SASI_Mm01_00127553 predicted 334
8 SASI_Mm01_00127554 predicted 612
9 SASI_Mm01_00127555 predicted 399
10 SASI_Mm01_00127556 predicted 916
11 SASI_Mm01_00127550 predicted 768
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_028173
VALIDATED
TRAM1 MISSION shRNA Bacterial Glycerol Stock
translocation associated membrane protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000098610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028173.1-2639s1c1
Sequence:CCGGGCTGCTAGAAAGTCATGCTTTCTCGAGAAAGCATGACTTTCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028173.1-815s1c1
Sequence:CCGGGCTGCACTATTTCGTTGAATTCTCGAGAATTCAACGAAATAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028173.1-339s1c1
Sequence:CCGGGCTACTGAATCAGCATCCCTACTCGAGTAGGGATGCTGATTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028173.1-816s1c1
Sequence:CCGGCTGCACTATTTCGTTGAATTTCTCGAGAAATTCAACGAAATAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028173.1-411s1c1
Sequence:CCGGGCGATAATTATTCATGCCATACTCGAGTATGGCATGAATAATTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028173.4-814s21c1
Sequence:CCGGGCTGCACTATTTCGTTGAATTCTCGAGAATTCAACGAAATAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028173.4-1035s21c1
Sequence:CCGGTCGCTGTTCTCGCGTCCATTTCTCGAGAAATGGACGCGAGAACAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028173.4-838s21c1
Sequence:CCGGTTTCCACATTTCTCGTCTATTCTCGAGAATAGACGAGAAATGTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000305344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028173.4-1271s21c1
Sequence:CCGGATCGGAAGCTGACTGATTATTCTCGAGAATAATCAGTCAGCTTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000309592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028173.4-338s21c1
Sequence:CCGGGCTACTGAATCAGCATCCCTACTCGAGTAGGGATGCTGATTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_028173
VALIDATED
TRAM1 MISSION shRNA shRNA Plasmid DNA
translocation associated membrane protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000098610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028173.1-2639s1c1
Sequence:CCGGGCTGCTAGAAAGTCATGCTTTCTCGAGAAAGCATGACTTTCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028173.1-815s1c1
Sequence:CCGGGCTGCACTATTTCGTTGAATTCTCGAGAATTCAACGAAATAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028173.1-339s1c1
Sequence:CCGGGCTACTGAATCAGCATCCCTACTCGAGTAGGGATGCTGATTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028173.1-816s1c1
Sequence:CCGGCTGCACTATTTCGTTGAATTTCTCGAGAAATTCAACGAAATAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028173.1-411s1c1
Sequence:CCGGGCGATAATTATTCATGCCATACTCGAGTATGGCATGAATAATTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028173.4-814s21c1
Sequence:CCGGGCTGCACTATTTCGTTGAATTCTCGAGAATTCAACGAAATAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028173.4-1035s21c1
Sequence:CCGGTCGCTGTTCTCGCGTCCATTTCTCGAGAAATGGACGCGAGAACAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028173.4-838s21c1
Sequence:CCGGTTTCCACATTTCTCGTCTATTCTCGAGAATAGACGAGAAATGTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000305344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028173.4-1271s21c1
Sequence:CCGGATCGGAAGCTGACTGATTATTCTCGAGAATAATCAGTCAGCTTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000309592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028173.4-338s21c1
Sequence:CCGGGCTACTGAATCAGCATCCCTACTCGAGTAGGGATGCTGATTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_028173
VALIDATED
TRAM1 MISSION shRNA Lentiviral Transduction Particles
translocation associated membrane protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000098610    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_028173.1-2639s1c1
Sequence:CCGGGCTGCTAGAAAGTCATGCTTTCTCGAGAAAGCATGACTTTCTAGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028173.1-815s1c1
Sequence:CCGGGCTGCACTATTTCGTTGAATTCTCGAGAATTCAACGAAATAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028173.1-339s1c1
Sequence:CCGGGCTACTGAATCAGCATCCCTACTCGAGTAGGGATGCTGATTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_028173.1-816s1c1
Sequence:CCGGCTGCACTATTTCGTTGAATTTCTCGAGAAATTCAACGAAATAGTGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_028173.1-411s1c1
Sequence:CCGGGCGATAATTATTCATGCCATACTCGAGTATGGCATGAATAATTATCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309656    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028173.4-814s21c1
Sequence:CCGGGCTGCACTATTTCGTTGAATTCTCGAGAATTCAACGAAATAGTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305343    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028173.4-1035s21c1
Sequence:CCGGTCGCTGTTCTCGCGTCCATTTCTCGAGAAATGGACGCGAGAACAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305345    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028173.4-838s21c1
Sequence:CCGGTTTCCACATTTCTCGTCTATTCTCGAGAATAGACGAGAAATGTGGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000305344    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028173.4-1271s21c1
Sequence:CCGGATCGGAAGCTGACTGATTATTCTCGAGAATAATCAGTCAGCTTCCGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000309592    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_028173.4-338s21c1
Sequence:CCGGGCTACTGAATCAGCATCCCTACTCGAGTAGGGATGCTGATTCAGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014294
VALIDATED
TRAM1 MISSION shRNA Bacterial Glycerol Stock
translocation associated membrane protein 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000062938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014294.3-385s1c1
Sequence:CCGGCCTTTATTACTATGGCATCAACTCGAGTTGATGCCATAGTAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014294.3-1034s1c1
Sequence:CCGGACTGGAAACTTCAATGTGTTACTCGAGTAACACATTGAAGTTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014294.3-1177s1c1
Sequence:CCGGGAAGAAACCAACAGTAACTAACTCGAGTTAGTTACTGTTGGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014294.3-618s1c1
Sequence:CCGGCAACTATCTTATGGAGGGCTTCTCGAGAAGCCCTCCATAAGATAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_014294.3-441s1c1
Sequence:CCGGCGATAATTATTCATGCCGTAACTCGAGTTACGGCATGAATAATTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014294.4-1661s21c1
Sequence:CCGGTGTTCTAAGAAGGCCATATTTCTCGAGAAATATGGCCTTCTTAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014294.4-1032s21c1
Sequence:CCGGACTGGAAACTTCAATGTGTTACTCGAGTAACACATTGAAGTTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014294.4-616s21c1
Sequence:CCGGCAACTATCTTATGGAGGGCTTCTCGAGAAGCCCTCCATAAGATAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000300865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014294.4-1175s21c1
Sequence:CCGGGAAGAAACCAACAGTAACTAACTCGAGTTAGTTACTGTTGGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014294.4-1063s21c1
Sequence:CCGGTCGCTGTTCTGGCATCCATTTCTCGAGAAATGGATGCCAGAACAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014294
VALIDATED
TRAM1 MISSION shRNA shRNA Plasmid DNA
translocation associated membrane protein 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000062938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014294.3-385s1c1
Sequence:CCGGCCTTTATTACTATGGCATCAACTCGAGTTGATGCCATAGTAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014294.3-1034s1c1
Sequence:CCGGACTGGAAACTTCAATGTGTTACTCGAGTAACACATTGAAGTTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014294.3-1177s1c1
Sequence:CCGGGAAGAAACCAACAGTAACTAACTCGAGTTAGTTACTGTTGGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014294.3-618s1c1
Sequence:CCGGCAACTATCTTATGGAGGGCTTCTCGAGAAGCCCTCCATAAGATAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_014294.3-441s1c1
Sequence:CCGGCGATAATTATTCATGCCGTAACTCGAGTTACGGCATGAATAATTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014294.4-1661s21c1
Sequence:CCGGTGTTCTAAGAAGGCCATATTTCTCGAGAAATATGGCCTTCTTAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014294.4-1032s21c1
Sequence:CCGGACTGGAAACTTCAATGTGTTACTCGAGTAACACATTGAAGTTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014294.4-616s21c1
Sequence:CCGGCAACTATCTTATGGAGGGCTTCTCGAGAAGCCCTCCATAAGATAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000300865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014294.4-1175s21c1
Sequence:CCGGGAAGAAACCAACAGTAACTAACTCGAGTTAGTTACTGTTGGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014294.4-1063s21c1
Sequence:CCGGTCGCTGTTCTGGCATCCATTTCTCGAGAAATGGATGCCAGAACAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014294
VALIDATED
TRAM1 MISSION shRNA Lentiviral Transduction Particles
translocation associated membrane protein 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000062938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014294.3-385s1c1
Sequence:CCGGCCTTTATTACTATGGCATCAACTCGAGTTGATGCCATAGTAATAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062940    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014294.3-1034s1c1
Sequence:CCGGACTGGAAACTTCAATGTGTTACTCGAGTAACACATTGAAGTTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062941    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1 Clone ID:NM_014294.3-1177s1c1
Sequence:CCGGGAAGAAACCAACAGTAACTAACTCGAGTTAGTTACTGTTGGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014294.3-618s1c1
Sequence:CCGGCAACTATCTTATGGAGGGCTTCTCGAGAAGCCCTCCATAAGATAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062939    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.57 Cell Line: A549
TRC Version: 1 Clone ID:NM_014294.3-441s1c1
Sequence:CCGGCGATAATTATTCATGCCGTAACTCGAGTTACGGCATGAATAATTATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304158    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014294.4-1661s21c1
Sequence:CCGGTGTTCTAAGAAGGCCATATTTCTCGAGAAATATGGCCTTCTTAGAACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300789    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.96 Cell Line: A549
TRC Version: 2 Clone ID:NM_014294.4-1032s21c1
Sequence:CCGGACTGGAAACTTCAATGTGTTACTCGAGTAACACATTGAAGTTTCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300788    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014294.4-616s21c1
Sequence:CCGGCAACTATCTTATGGAGGGCTTCTCGAGAAGCCCTCCATAAGATAGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000300865    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_014294.4-1175s21c1
Sequence:CCGGGAAGAAACCAACAGTAACTAACTCGAGTTAGTTACTGTTGGTTTCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304157    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_014294.4-1063s21c1
Sequence:CCGGTCGCTGTTCTGGCATCCATTTCTCGAGAAATGGATGCCAGAACAGCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks