EMAIL THIS PAGE TO A FRIEND

TRAM1L1

translocation associated membrane protein 1-like 1

UniProtKB ID: Q8N609, Q8N2L7
Gene ID:
Mouse(229801) translocation associated membrane protein 1-like 1
Rat(310846) translocation associated membrane protein 1-like 1
domestic guinea pig(100719773) translocation associated membrane protein 1-like 1
naked mole-rat(101708202) translocation associated membrane protein 1-like 1
cow(505068) translocation associated membrane protein 1-like 1
sheep(101112059) translocation associated membrane protein 1-like 1
domestic cat(101095251) translocation associated membrane protein 1-like 1
dog(487917) translocation associated membrane protein 1-like 1
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_146140 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146140 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146140 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_152402 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_152402 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_152402 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_152402 Rosetta Predictions human pricing
NM_001107724 Rosetta Predictions rat pricing
NM_146140 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_152402 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00366084 predicted 1294
2 SASI_Hs02_00366085 predicted 1056
3 SASI_Hs01_00133752 predicted 1329
4 SASI_Hs01_00133753 predicted 1122
5 SASI_Hs01_00133754 predicted 797
6 SASI_Hs02_00366086 predicted 1081
7 SASI_Hs02_00366087 predicted 383
8 SASI_Hs01_00133756 predicted 1289
9 SASI_Hs01_00133758 predicted 471
10 SASI_Hs01_00133759 predicted 396
11 SASI_Hs01_00133750 predicted 385
12 SASI_Hs01_00133751 predicted 816
13 SASI_Hs01_00133755 predicted 811
14 SASI_Hs01_00133757 predicted 914
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107724 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00231645 predicted 1082
2 SASI_Rn02_00231646 predicted 961
3 SASI_Rn02_00231647 predicted 872
4 SASI_Rn02_00231648 predicted 1027
5 SASI_Rn02_00231649 predicted 1260
6 SASI_Rn02_00231650 predicted 981
7 SASI_Rn02_00231651 predicted 907
8 SASI_Rn02_00231652 predicted 1211
9 SASI_Rn02_00231653 predicted 680
10 SASI_Rn02_00231654 predicted 224
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146140 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164725 predicted 1061
2 SASI_Mm01_00164726 predicted 1018
3 SASI_Mm01_00164727 predicted 781
4 SASI_Mm01_00164728 predicted 1285
5 SASI_Mm01_00164729 predicted 938
6 SASI_Mm01_00164730 predicted 665
7 SASI_Mm01_00164731 predicted 1235
8 SASI_Mm01_00164732 predicted 1187
9 SASI_Mm01_00164733 predicted 978
10 SASI_Mm01_00164734 predicted 1114
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146140
VALIDATED
TRAM1L1 MISSION shRNA Bacterial Glycerol Stock
translocation associated membrane protein 1-like 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146140.3-1571s21c1
Sequence:CCGGCCAGTGTTCTTTATCGCATTACTCGAGTAATGCGATAAAGAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146140.3-1188s21c1
Sequence:CCGGATGGAGTGGAGAATCCGAATACTCGAGTATTCGGATTCTCCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146140.3-907s21c1
Sequence:CCGGTCTGTGGCCTATCGTGTTTATCTCGAGATAAACACGATAGGCCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146140.3-685s21c1
Sequence:CCGGTCATAGCTTTCCGGAGCTTTACTCGAGTAAAGCTCCGGAAAGCTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000348701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146140.3-445s21c1
Sequence:CCGGTCAGGAGTACGTGCTAGATAACTCGAGTTATCTAGCACGTACTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146140.2-867s1c1
Sequence:CCGGCGTGACATTGATTGTCTCGGTCTCGAGACCGAGACAATCAATGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_146140.2-1498s1c1
Sequence:CCGGCCAGTGTTCTTTATCGCATTACTCGAGTAATGCGATAAAGAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_146140.2-601s1c1
Sequence:CCGGGCTTACTGGTTTCATAGCTTTCTCGAGAAAGCTATGAAACCAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_146140.2-1058s1c1
Sequence:CCGGCGAACCTTCATGTTTGTGGAACTCGAGTTCCACAAACATGAAGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000098609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146140.2-117s1c1
Sequence:CCGGCCCGGTGTTGAGCCACGAATTCTCGAGAATTCGTGGCTCAACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146140
VALIDATED
TRAM1L1 MISSION shRNA shRNA Plasmid DNA
translocation associated membrane protein 1-like 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146140.3-1571s21c1
Sequence:CCGGCCAGTGTTCTTTATCGCATTACTCGAGTAATGCGATAAAGAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146140.3-1188s21c1
Sequence:CCGGATGGAGTGGAGAATCCGAATACTCGAGTATTCGGATTCTCCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146140.3-907s21c1
Sequence:CCGGTCTGTGGCCTATCGTGTTTATCTCGAGATAAACACGATAGGCCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146140.3-685s21c1
Sequence:CCGGTCATAGCTTTCCGGAGCTTTACTCGAGTAAAGCTCCGGAAAGCTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000348701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146140.3-445s21c1
Sequence:CCGGTCAGGAGTACGTGCTAGATAACTCGAGTTATCTAGCACGTACTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146140.2-867s1c1
Sequence:CCGGCGTGACATTGATTGTCTCGGTCTCGAGACCGAGACAATCAATGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_146140.2-1498s1c1
Sequence:CCGGCCAGTGTTCTTTATCGCATTACTCGAGTAATGCGATAAAGAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_146140.2-601s1c1
Sequence:CCGGGCTTACTGGTTTCATAGCTTTCTCGAGAAAGCTATGAAACCAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_146140.2-1058s1c1
Sequence:CCGGCGAACCTTCATGTTTGTGGAACTCGAGTTCCACAAACATGAAGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000098609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146140.2-117s1c1
Sequence:CCGGCCCGGTGTTGAGCCACGAATTCTCGAGAATTCGTGGCTCAACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146140
VALIDATED
TRAM1L1 MISSION shRNA Lentiviral Transduction Particles
translocation associated membrane protein 1-like 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_146140.3-1571s21c1
Sequence:CCGGCCAGTGTTCTTTATCGCATTACTCGAGTAATGCGATAAAGAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348699    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146140.3-1188s21c1
Sequence:CCGGATGGAGTGGAGAATCCGAATACTCGAGTATTCGGATTCTCCACTCCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348700    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146140.3-907s21c1
Sequence:CCGGTCTGTGGCCTATCGTGTTTATCTCGAGATAAACACGATAGGCCACAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348702    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146140.3-685s21c1
Sequence:CCGGTCATAGCTTTCCGGAGCTTTACTCGAGTAAAGCTCCGGAAAGCTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000348701    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_146140.3-445s21c1
Sequence:CCGGTCAGGAGTACGTGCTAGATAACTCGAGTTATCTAGCACGTACTCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098608    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146140.2-867s1c1
Sequence:CCGGCGTGACATTGATTGTCTCGGTCTCGAGACCGAGACAATCAATGTCACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.9 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_146140.2-1498s1c1
Sequence:CCGGCCAGTGTTCTTTATCGCATTACTCGAGTAATGCGATAAAGAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098607    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_146140.2-601s1c1
Sequence:CCGGGCTTACTGGTTTCATAGCTTTCTCGAGAAAGCTATGAAACCAGTAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.61 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_146140.2-1058s1c1
Sequence:CCGGCGAACCTTCATGTTTGTGGAACTCGAGTTCCACAAACATGAAGGTTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000098609    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146140.2-117s1c1
Sequence:CCGGCCCGGTGTTGAGCCACGAATTCTCGAGAATTCGTGGCTCAACACCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_152402
TRAM1L1 MISSION shRNA Bacterial Glycerol Stock
translocation associated membrane protein 1-like 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152402.1-319s1c1
Sequence:CCGGGCATCCATCGTGTTTCTCACTCTCGAGAGTGAGAAACACGATGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152402.1-537s1c1
Sequence:CCGGGTTTAACGAGTCTGGTCAGTTCTCGAGAACTGACCAGACTCGTTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152402.1-412s1c1
Sequence:CCGGGTCAAAGATTTGGCCACGGTTCTCGAGAACCGTGGCCAAATCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152402.1-1036s1c1
Sequence:CCGGGATGCCCTTACTGGAAATGTACTCGAGTACATTTCCAGTAAGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152402.1-1146s1c1
Sequence:CCGGGAGGTGGGTAGAAGATTCTAACTCGAGTTAGAATCTTCTACCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152402.1-1319s1c1
Sequence:CCGGCTGCAAAGGAATCTGCTCTTTCTCGAGAAAGAGCAGATTCCTTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152402.1-386s1c1
Sequence:CCGGGCTCAAAGTCCCTCTATTATTCTCGAGAATAATAGAGGGACTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134313    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152402.1-1343s1c1
Sequence:CCGGGTTTCTTTCTGCACTAGAGATCTCGAGATCTCTAGTGCAGAAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000135891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152402.1-913s1c1
Sequence:CCGGGAGAAGTACCAGAAAGGCATACTCGAGTATGCCTTTCTGGTACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152402.1-628s1c1
Sequence:CCGGCCAACTCTTATATGGAAGGCTCTCGAGAGCCTTCCATATAAGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_152402
TRAM1L1 MISSION shRNA shRNA Plasmid DNA
translocation associated membrane protein 1-like 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152402.1-319s1c1
Sequence:CCGGGCATCCATCGTGTTTCTCACTCTCGAGAGTGAGAAACACGATGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152402.1-537s1c1
Sequence:CCGGGTTTAACGAGTCTGGTCAGTTCTCGAGAACTGACCAGACTCGTTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152402.1-412s1c1
Sequence:CCGGGTCAAAGATTTGGCCACGGTTCTCGAGAACCGTGGCCAAATCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152402.1-1036s1c1
Sequence:CCGGGATGCCCTTACTGGAAATGTACTCGAGTACATTTCCAGTAAGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152402.1-1146s1c1
Sequence:CCGGGAGGTGGGTAGAAGATTCTAACTCGAGTTAGAATCTTCTACCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152402.1-1319s1c1
Sequence:CCGGCTGCAAAGGAATCTGCTCTTTCTCGAGAAAGAGCAGATTCCTTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152402.1-386s1c1
Sequence:CCGGGCTCAAAGTCCCTCTATTATTCTCGAGAATAATAGAGGGACTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134313    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152402.1-1343s1c1
Sequence:CCGGGTTTCTTTCTGCACTAGAGATCTCGAGATCTCTAGTGCAGAAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000135891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152402.1-913s1c1
Sequence:CCGGGAGAAGTACCAGAAAGGCATACTCGAGTATGCCTTTCTGGTACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152402.1-628s1c1
Sequence:CCGGCCAACTCTTATATGGAAGGCTCTCGAGAGCCTTCCATATAAGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_152402
TRAM1L1 MISSION shRNA Lentiviral Transduction Particles
translocation associated membrane protein 1-like 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137963    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152402.1-319s1c1
Sequence:CCGGGCATCCATCGTGTTTCTCACTCTCGAGAGTGAGAAACACGATGGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136205    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152402.1-537s1c1
Sequence:CCGGGTTTAACGAGTCTGGTCAGTTCTCGAGAACTGACCAGACTCGTTAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137861    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152402.1-412s1c1
Sequence:CCGGGTCAAAGATTTGGCCACGGTTCTCGAGAACCGTGGCCAAATCTTTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136126    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152402.1-1036s1c1
Sequence:CCGGGATGCCCTTACTGGAAATGTACTCGAGTACATTTCCAGTAAGGGCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136029    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152402.1-1146s1c1
Sequence:CCGGGAGGTGGGTAGAAGATTCTAACTCGAGTTAGAATCTTCTACCCACCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135755    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152402.1-1319s1c1
Sequence:CCGGCTGCAAAGGAATCTGCTCTTTCTCGAGAAAGAGCAGATTCCTTTGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152402.1-386s1c1
Sequence:CCGGGCTCAAAGTCCCTCTATTATTCTCGAGAATAATAGAGGGACTTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134313    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_152402.1-1343s1c1
Sequence:CCGGGTTTCTTTCTGCACTAGAGATCTCGAGATCTCTAGTGCAGAAAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000135891    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_152402.1-913s1c1
Sequence:CCGGGAGAAGTACCAGAAAGGCATACTCGAGTATGCCTTTCTGGTACTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136108    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_152402.1-628s1c1
Sequence:CCGGCCAACTCTTATATGGAAGGCTCTCGAGAGCCTTCCATATAAGAGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks