EMAIL THIS PAGE TO A FRIEND

TRAM2

translocation associated membrane protein 2

UniProtKB ID: Q15035, A8K6T6
Gene ID:
Human(9697) Summary: TRAM2 is a component of the translocon, a gated macromolecular channel that controls the posttranslational processing of nascent secretory and membrane proteins at the endoplasmic reticulum (ER) membrane.[supplied by OMIM, Jul 2004]
Mouse(170829) translocating chain-associating membrane protein 2
Rat(684534) translocation associated membrane protein 2
Zebrafish(406344) translocation associated membrane protein 2
chicken(422040) translocation associated membrane protein 2
domestic cat(101084287) translocation associated membrane protein 2
Horse(100069225) translocation associated membrane protein 2
dog(474936) translocation associated membrane protein 2
cow(617287) translocation associated membrane protein 2
sheep(101119083) translocation associated membrane protein 2
naked mole-rat(101717867) translocation associated membrane protein 2
domestic guinea pig(100730382) translocation associated membrane protein 2
74 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_012288 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_012288 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_012288 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_133252 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_133252 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_133252 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU027821 MISSION® esiRNA esiRNA human TRAM2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_012288 Rosetta Predictions human pricing
XM_001070862 Rosetta Predictions rat pricing
NM_133252 Rosetta Predictions mouse pricing
NM_177409 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_012288 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00202994 predicted 572
2 SASI_Hs01_00202995 predicted 1102
3 SASI_Hs01_00202996 predicted 670
4 SASI_Hs01_00202998 predicted 370
5 SASI_Hs01_00203000 predicted 682
6 SASI_Hs01_00203001 predicted 470
7 SASI_Hs01_00203003 predicted 756
8 SASI_Hs02_00344031 predicted 815
9 SASI_Hs02_00344032 predicted 1249
10 SASI_Hs02_00344033 predicted 996
11 SASI_Hs01_00202997 predicted 1561
12 SASI_Hs01_00202999 predicted 1357
13 SASI_Hs01_00203002 predicted 869
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001070862 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00333110 predicted 764
2 SASI_Rn02_00333111 predicted 528
3 SASI_Rn02_00333112 predicted 544
4 SASI_Rn02_00333113 predicted 451
5 SASI_Rn02_00333114 predicted 554
6 SASI_Rn02_00333115 predicted 508
7 SASI_Rn02_00333116 predicted 566
8 SASI_Rn02_00333117 predicted 1176
9 SASI_Rn02_00333118 predicted 425
10 SASI_Rn02_00333119 predicted 371
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_133252 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00338506 predicted 528
2 SASI_Mm01_00157142 predicted 309
3 SASI_Mm02_00338507 predicted 545
4 SASI_Mm02_00338508 predicted 592
5 SASI_Mm02_00338509 predicted 682
6 SASI_Mm02_00338510 predicted 1063
7 SASI_Mm02_00338511 predicted 880
8 SASI_Mm02_00338512 predicted 790
9 SASI_Mm02_00338513 predicted 1128
10 SASI_Mm02_00338514 predicted 489
11 SASI_Mm01_00157141 predicted 373
12 SASI_Mm01_00157143 predicted 280
13 SASI_Mm01_00157144 predicted 963
14 SASI_Mm01_00157145 predicted 257
15 SASI_Mm01_00157146 predicted 323
16 SASI_Mm01_00157147 predicted 300
17 SASI_Mm01_00157148 predicted 285
18 SASI_Mm01_00157149 predicted 292
19 SASI_Mm01_00157150 predicted 353
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177409 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00347615 predicted 546
2 SASI_Mm01_00045355 predicted 321
3 SASI_Mm02_00347616 predicted 559
4 SASI_Mm02_00347617 predicted 608
5 SASI_Mm02_00347618 predicted 694
6 SASI_Mm02_00347619 predicted 1073
7 SASI_Mm02_00347620 predicted 898
8 SASI_Mm02_00347621 predicted 812
9 SASI_Mm02_00347622 predicted 1135
10 SASI_Mm02_00347623 predicted 506
11 SASI_Mm01_00045354 predicted 394
12 SASI_Mm01_00045356 predicted 303
13 SASI_Mm01_00045357 predicted 977
14 SASI_Mm01_00045358 predicted 266
15 SASI_Mm01_00045359 predicted 331
16 SASI_Mm01_00045360 predicted 312
17 SASI_Mm01_00045361 predicted 308
18 SASI_Mm01_00045362 predicted 306
19 SASI_Mm01_00045363 predicted 371
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_012288
VALIDATED
TRAM2 MISSION shRNA Bacterial Glycerol Stock
translocation associated membrane protein 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000143429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012288.2-678s1c1
Sequence:CCGGGAGCTATACTTCCAGAAGGTACTCGAGTACCTTCTGGAAGTATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142331    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012288.2-3887s1c1
Sequence:CCGGCGGGTGTGCTAAGGGTTTATTCTCGAGAATAAACCCTTAGCACACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012288.2-195s1c1
Sequence:CCGGGAGTTCGTCATCCACAACCATCTCGAGATGGTTGTGGATGACGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_012288.2-527s1c1
Sequence:CCGGCTCGGTGATTTGGTGCTTCTACTCGAGTAGAAGCACCAAATCACCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000141843    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012288.2-2624s1c1
Sequence:CCGGGCAGTAGCTTACGCCTGTTATCTCGAGATAACAGGCGTAAGCTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012288.2-417s1c1
Sequence:CCGGGCTGTGGTTCAGGAGTACATTCTCGAGAATGTACTCCTGAACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_012288.2-1232s1c1
Sequence:CCGGCCCACGGACTAAGAAACTCAACTCGAGTTGAGTTTCTTAGTCCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012288.2-995s1c1
Sequence:CCGGGAAAGGGAACTTCAACACTTTCTCGAGAAAGTGTTGAAGTTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012288.2-557s1c1
Sequence:CCGGGACGGAAGGATACTTAACAAACTCGAGTTTGTTAAGTATCCTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_012288
VALIDATED
TRAM2 MISSION shRNA shRNA Plasmid DNA
translocation associated membrane protein 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000143429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012288.2-678s1c1
Sequence:CCGGGAGCTATACTTCCAGAAGGTACTCGAGTACCTTCTGGAAGTATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142331    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012288.2-3887s1c1
Sequence:CCGGCGGGTGTGCTAAGGGTTTATTCTCGAGAATAAACCCTTAGCACACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012288.2-195s1c1
Sequence:CCGGGAGTTCGTCATCCACAACCATCTCGAGATGGTTGTGGATGACGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_012288.2-527s1c1
Sequence:CCGGCTCGGTGATTTGGTGCTTCTACTCGAGTAGAAGCACCAAATCACCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000141843    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012288.2-2624s1c1
Sequence:CCGGGCAGTAGCTTACGCCTGTTATCTCGAGATAACAGGCGTAAGCTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012288.2-417s1c1
Sequence:CCGGGCTGTGGTTCAGGAGTACATTCTCGAGAATGTACTCCTGAACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_012288.2-1232s1c1
Sequence:CCGGCCCACGGACTAAGAAACTCAACTCGAGTTGAGTTTCTTAGTCCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012288.2-995s1c1
Sequence:CCGGGAAAGGGAACTTCAACACTTTCTCGAGAAAGTGTTGAAGTTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012288.2-557s1c1
Sequence:CCGGGACGGAAGGATACTTAACAAACTCGAGTTTGTTAAGTATCCTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_012288
VALIDATED
TRAM2 MISSION shRNA Lentiviral Transduction Particles
translocation associated membrane protein 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000143429    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012288.2-678s1c1
Sequence:CCGGGAGCTATACTTCCAGAAGGTACTCGAGTACCTTCTGGAAGTATAGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142331    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_012288.2-3887s1c1
Sequence:CCGGCGGGTGTGCTAAGGGTTTATTCTCGAGAATAAACCCTTAGCACACCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141770    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012288.2-195s1c1
Sequence:CCGGGAGTTCGTCATCCACAACCATCTCGAGATGGTTGTGGATGACGAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141247    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_012288.2-527s1c1
Sequence:CCGGCTCGGTGATTTGGTGCTTCTACTCGAGTAGAAGCACCAAATCACCGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000141843    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_012288.2-2624s1c1
Sequence:CCGGGCAGTAGCTTACGCCTGTTATCTCGAGATAACAGGCGTAAGCTACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142389    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_012288.2-417s1c1
Sequence:CCGGGCTGTGGTTCAGGAGTACATTCTCGAGAATGTACTCCTGAACCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122746    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: HeLa
TRC Version: 1 Clone ID:NM_012288.2-1232s1c1
Sequence:CCGGCCCACGGACTAAGAAACTCAACTCGAGTTGAGTTTCTTAGTCCGTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144950    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012288.2-995s1c1
Sequence:CCGGGAAAGGGAACTTCAACACTTTCTCGAGAAAGTGTTGAAGTTCCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144580    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_012288.2-557s1c1
Sequence:CCGGGACGGAAGGATACTTAACAAACTCGAGTTTGTTAAGTATCCTTCCGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_133252
VALIDATED
TRAM2 MISSION shRNA Bacterial Glycerol Stock
translocation associated membrane protein 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000125643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133252.1-1120s1c1
Sequence:CCGGCCTCAAGAGAGAACCTGGTTACTCGAGTAACCAGGTTCTCTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133252.1-497s1c1
Sequence:CCGGGTGATCGTAACAGAAGGATATCTCGAGATATCCTTCTGTTACGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133252.1-373s1c1
Sequence:CCGGCCAGGAGTACATCTTAGACAACTCGAGTTGTCTAAGATGTACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133252.1-670s1c1
Sequence:CCGGGCTGCAATACATTTGTCTGTACTCGAGTACAGACAAATGTATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000125639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133252.1-1214s1c1
Sequence:CCGGCACTTTGCTGAGAACAGGGATCTCGAGATCCCTGTTCTCAGCAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_133252
VALIDATED
TRAM2 MISSION shRNA shRNA Plasmid DNA
translocation associated membrane protein 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000125643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133252.1-1120s1c1
Sequence:CCGGCCTCAAGAGAGAACCTGGTTACTCGAGTAACCAGGTTCTCTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133252.1-497s1c1
Sequence:CCGGGTGATCGTAACAGAAGGATATCTCGAGATATCCTTCTGTTACGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133252.1-373s1c1
Sequence:CCGGCCAGGAGTACATCTTAGACAACTCGAGTTGTCTAAGATGTACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133252.1-670s1c1
Sequence:CCGGGCTGCAATACATTTGTCTGTACTCGAGTACAGACAAATGTATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000125639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133252.1-1214s1c1
Sequence:CCGGCACTTTGCTGAGAACAGGGATCTCGAGATCCCTGTTCTCAGCAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_133252
VALIDATED
TRAM2 MISSION shRNA Lentiviral Transduction Particles
translocation associated membrane protein 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000125643    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133252.1-1120s1c1
Sequence:CCGGCCTCAAGAGAGAACCTGGTTACTCGAGTAACCAGGTTCTCTCTTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125642    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133252.1-497s1c1
Sequence:CCGGGTGATCGTAACAGAAGGATATCTCGAGATATCCTTCTGTTACGATCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125641    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_133252.1-373s1c1
Sequence:CCGGCCAGGAGTACATCTTAGACAACTCGAGTTGTCTAAGATGTACTCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125640    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_133252.1-670s1c1
Sequence:CCGGGCTGCAATACATTTGTCTGTACTCGAGTACAGACAAATGTATTGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000125639    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_133252.1-1214s1c1
Sequence:CCGGCACTTTGCTGAGAACAGGGATCTCGAGATCCCTGTTCTCAGCAAAGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks