EMAIL THIS PAGE TO A FRIEND

TRANK1

tetratricopeptide repeat and ankyrin repeat containing 1

Synonyms: LBA1
UniProtKB ID: O15050, Q8N8K0
Gene ID:
Mouse(320429) tetratricopeptide repeat and ankyrin repeat containing 1
Rat(316022) tetratricopeptide repeat and ankyrin repeat containing 1
chicken(420728) tetratricopeptide repeat and ankyrin repeat containing 1
domestic cat(101091555) tetratricopeptide repeat and ankyrin repeat containing 1
dog(477018) tetratricopeptide repeat and ankyrin repeat containing 1
domestic guinea pig(100717669) tetratricopeptide repeat and ankyrin repeat containing 1
naked mole-rat(101697411) tetratricopeptide repeat and ankyrin repeat containing 1
Domestic Rabbit(100344745) tetratricopeptide repeat and ankyrin repeat containing 1
cow(509859) tetratricopeptide repeat and ankyrin repeat containing 1
sheep(101114219) tetratricopeptide repeat and ankyrin repeat containing 1
179 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA035508 Anti-TRANK1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014831 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014831 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014831 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-XM_001481067 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-XM_001481067 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-XM_001481067 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014831 Rosetta Predictions human pricing
XM_047357 Rosetta Predictions human pricing
XM_001076394 Rosetta Predictions rat pricing
XM_236660 Rosetta Predictions rat pricing
XM_001005347 Rosetta Predictions mouse pricing
XM_001481067 Rosetta Predictions mouse pricing
XM_903018 Rosetta Predictions mouse pricing
XM_915629 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014831 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346376 predicted 6822
2 SASI_Hs02_00346377 predicted 2482
3 SASI_Hs02_00346378 predicted 4228
4 SASI_Hs02_00346379 predicted 7307
5 SASI_Hs02_00346380 predicted 1329
6 SASI_Hs02_00346381 predicted 365
7 SASI_Hs02_00346382 predicted 7168
8 SASI_Hs02_00346383 predicted 3038
9 SASI_Hs02_00346384 predicted 2709
10 SASI_Hs02_00346385 predicted 412
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_047357 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00292076 predicted 3422
2 SASI_Hs01_00292077 predicted 8785
3 SASI_Hs01_00292078 predicted 6192
4 SASI_Hs01_00292079 predicted 9272
5 SASI_Hs01_00292080 predicted 3293
6 SASI_Hs01_00292081 predicted 2324
7 SASI_Hs01_00292082 predicted 7555
8 SASI_Hs01_00292083 predicted 1123
9 SASI_Hs01_00292084 predicted 9127
10 SASI_Hs01_00292085 predicted 5008
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001076394 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00353095 predicted 1250
2 SASI_Rn02_00353096 predicted 2746
3 SASI_Rn02_00353097 predicted 1929
4 SASI_Rn02_00353098 predicted 5966
5 SASI_Rn02_00353099 predicted 5067
6 SASI_Rn02_00353100 predicted 6728
7 SASI_Rn02_00353101 predicted 2018
8 SASI_Rn02_00353102 predicted 2400
9 SASI_Rn02_00353103 predicted 4769
10 SASI_Rn02_00353104 predicted 7274
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_236660 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00390299 predicted 1250
2 SASI_Rn02_00390300 predicted 2752
3 SASI_Rn02_00390301 predicted 1935
4 SASI_Rn02_00390302 predicted 5960
5 SASI_Rn02_00390303 predicted 5066
6 SASI_Rn02_00390304 predicted 6728
7 SASI_Rn02_00390305 predicted 2011
8 SASI_Rn02_00390306 predicted 2404
9 SASI_Rn02_00390307 predicted 4769
10 SASI_Rn02_00390308 predicted 7270
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001005347 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00229458 predicted 608
2 SASI_Mm01_00229459 predicted 457
3 SASI_Mm01_00229460 predicted 640
4 SASI_Mm01_00229461 predicted 2377
5 SASI_Mm01_00229462 predicted 341
6 SASI_Mm01_00229463 predicted 3193
7 SASI_Mm01_00229464 predicted 765
8 SASI_Mm01_00229465 predicted 3184
9 SASI_Mm01_00229466 predicted 3474
10 SASI_Mm01_00229467 predicted 273
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001481067 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00421783 predicted 5278
2 SASI_Mm02_00421784 predicted 5639
3 SASI_Mm02_00421785 predicted 6043
4 SASI_Mm02_00421786 predicted 5899
5 SASI_Mm02_00421787 predicted 6080
6 SASI_Mm02_00421788 predicted 7821
7 SASI_Mm02_00421789 predicted 8635
8 SASI_Mm02_00421790 predicted 6197
9 SASI_Mm02_00421791 predicted 8623
10 SASI_Mm02_00421792 predicted 5714
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_903018 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00204306 predicted 366
2 SASI_Mm01_00204307 predicted 429
3 SASI_Mm01_00204308 predicted 242
4 SASI_Mm01_00204309 predicted 241
5 SASI_Mm01_00204310 predicted 274
6 SASI_Mm01_00204311 predicted 429
7 SASI_Mm01_00204312 predicted 233
8 SASI_Mm01_00204313 predicted 236
9 SASI_Mm01_00204314 predicted 237
10 SASI_Mm01_00204315 predicted 306
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_915629 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00439619 predicted 484
2 SASI_Mm02_00439620 predicted 2533
3 SASI_Mm02_00439621 predicted 2684
4 SASI_Mm02_00439622 predicted 3055
5 SASI_Mm02_00439623 predicted 5836
6 SASI_Mm02_00439624 predicted 7759
7 SASI_Mm02_00439625 predicted 8578
8 SASI_Mm02_00439626 predicted 8567
9 SASI_Mm02_00439627 predicted 5657
10 SASI_Mm02_00439628 predicted 3161
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014831
TRANK1 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat and ankyrin repeat containing 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000230566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014831.1-3395s21c1
Sequence:CCGGTACTGATTCTGAGGCTTATAACTCGAGTTATAAGCCTCAGAATCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014831.1-4915s21c1
Sequence:CCGGATGACCCTGGGCCCATATTAACTCGAGTTAATATGGGCCCAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014831.1-8434s21c1
Sequence:CCGGTTGGCTGGCAGGCCTTATAAGCTCGAGCTTATAAGGCCTGCCAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000230568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014831.1-6495s21c1
Sequence:CCGGATAGTCCGTGGCCTCTATTATCTCGAGATAATAGAGGCCACGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014831.1-3324s21c1
Sequence:GTACCGGTTAGCACTTGTGCTAACAATTCTCGAGAATTGTTAGCACAAGTGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014831
TRANK1 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat and ankyrin repeat containing 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000230566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014831.1-3395s21c1
Sequence:CCGGTACTGATTCTGAGGCTTATAACTCGAGTTATAAGCCTCAGAATCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014831.1-4915s21c1
Sequence:CCGGATGACCCTGGGCCCATATTAACTCGAGTTAATATGGGCCCAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014831.1-8434s21c1
Sequence:CCGGTTGGCTGGCAGGCCTTATAAGCTCGAGCTTATAAGGCCTGCCAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000230568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014831.1-6495s21c1
Sequence:CCGGATAGTCCGTGGCCTCTATTATCTCGAGATAATAGAGGCCACGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014831.1-3324s21c1
Sequence:GTACCGGTTAGCACTTGTGCTAACAATTCTCGAGAATTGTTAGCACAAGTGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014831
TRANK1 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat and ankyrin repeat containing 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000230566    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014831.1-3395s21c1
Sequence:CCGGTACTGATTCTGAGGCTTATAACTCGAGTTATAAGCCTCAGAATCAGTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230567    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014831.1-4915s21c1
Sequence:CCGGATGACCCTGGGCCCATATTAACTCGAGTTAATATGGGCCCAGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230569    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014831.1-8434s21c1
Sequence:CCGGTTGGCTGGCAGGCCTTATAAGCTCGAGCTTATAAGGCCTGCCAGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000230568    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014831.1-6495s21c1
Sequence:CCGGATAGTCCGTGGCCTCTATTATCTCGAGATAATAGAGGCCACGGACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218453    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014831.1-3324s21c1
Sequence:GTACCGGTTAGCACTTGTGCTAACAATTCTCGAGAATTGTTAGCACAAGTGCTAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_001481067
TRANK1 MISSION shRNA Bacterial Glycerol Stock
tetratricopeptide repeat and ankyrin repeat containing 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000229436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481067.1-6585s21c1
Sequence:CCGGATGACCCAGGGCCCATATTAACTCGAGTTAATATGGGCCCTGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000229437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481067.1-7824s21c1
Sequence:CCGGTTGACTCCTTCAGCGAAATAGCTCGAGCTATTTCGCTGAAGGAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481067.1-5429s21c1
Sequence:CCGGATCATACAAGGAGACTATTATCTCGAGATAATAGTCTCCTTGTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000218249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001481067.1-9624s21c1
Sequence:GTACCGGAGTGGCTACTGTGGTATATTTCTCGAGAAATATACCACAGTAGCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000226036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481067.1-1913s21c1
Sequence:CCGGTTGTCCAACCCTACCGAATTTCTCGAGAAATTCGGTAGGGTTGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_001481067
TRANK1 MISSION shRNA shRNA Plasmid DNA
tetratricopeptide repeat and ankyrin repeat containing 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000229436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481067.1-6585s21c1
Sequence:CCGGATGACCCAGGGCCCATATTAACTCGAGTTAATATGGGCCCTGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000229437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481067.1-7824s21c1
Sequence:CCGGTTGACTCCTTCAGCGAAATAGCTCGAGCTATTTCGCTGAAGGAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481067.1-5429s21c1
Sequence:CCGGATCATACAAGGAGACTATTATCTCGAGATAATAGTCTCCTTGTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000218249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001481067.1-9624s21c1
Sequence:GTACCGGAGTGGCTACTGTGGTATATTTCTCGAGAAATATACCACAGTAGCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000226036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481067.1-1913s21c1
Sequence:CCGGTTGTCCAACCCTACCGAATTTCTCGAGAAATTCGGTAGGGTTGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_001481067
TRANK1 MISSION shRNA Lentiviral Transduction Particles
tetratricopeptide repeat and ankyrin repeat containing 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000229436    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481067.1-6585s21c1
Sequence:CCGGATGACCCAGGGCCCATATTAACTCGAGTTAATATGGGCCCTGGGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000229437    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481067.1-7824s21c1
Sequence:CCGGTTGACTCCTTCAGCGAAATAGCTCGAGCTATTTCGCTGAAGGAGTCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226037    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481067.1-5429s21c1
Sequence:CCGGATCATACAAGGAGACTATTATCTCGAGATAATAGTCTCCTTGTATGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000218249    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:XM_001481067.1-9624s21c1
Sequence:GTACCGGAGTGGCTACTGTGGTATATTTCTCGAGAAATATACCACAGTAGCCACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000226036    
Product Details

Region:CDS
TRC Version: 2 Clone ID:XM_001481067.1-1913s21c1
Sequence:CCGGTTGTCCAACCCTACCGAATTTCTCGAGAAATTCGGTAGGGTTGGACAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks