EMAIL THIS PAGE TO A FRIEND

TRAP1

TNF receptor-associated protein 1

Synonyms: HSP 75 HSP75 HSP90L TRAP-1
UniProtKB ID: Q12931, D3DUC8, O43642, O75235, Q9UHL5
Gene ID:
Human(10131) Summary: This gene encodes a mitochondrial chaperone protein that is member of the heat shock protein 90 (HSP90) family. The encoded protein has ATPase activity and interacts with tumor necrosis factor type I. This protein may function in regulating cellular stress responses. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Mouse(68015) TNF receptor-associated protein 1
Rat(287069) TNF receptor-associated protein 1
fruit fly(35559) CG3152 gene product from transcript CG3152-RA
domestic cat(101094974) TNF receptor-associated protein 1
dog(490032) TNF receptor-associated protein 1
chicken(416666) TNF receptor-associated protein 1
Zebrafish(571959) TNF receptor-associated protein 1
cow(514472) TNF receptor-associated protein 1
sheep(101123343) TNF receptor-associated protein 1
naked mole-rat(101712583) TNF receptor-associated protein 1
domestic guinea pig(100718722) TNF receptor-associated protein 1
75 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1406929 Anti-TRAP1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
immunofluorescence, western blot pricing
AV00012 Anti-TRAP1 antibody produced in rabbit affinity isolated antibody rat, canine, guinea pig, human, mouse
western blot pricing
HPA041082 Anti-TRAP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
HPA044227 Anti-TRAP1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB2107838 Anti-TRAP1 antibody produced in rabbit affinity isolated antibody guinea pig, human
ELISA, western blot pricing
SAB1410064 Anti-TRAP1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human, mouse
ELISA, western blot pricing
SAB5200123 Monoclonal Anti-Trap1 - Alkaline Phosphatase antibody produced in mouse clone 3H4-2H6, purified immunoglobulin human, rat
western blot pricing
SAB5200124 Monoclonal Anti-Trap1 - Apc antibody produced in mouse clone 3H4-2H6, purified immunoglobulin human, rat
western blot pricing
SAB5200115 Monoclonal Anti-Trap1 - Atto 390 antibody produced in mouse clone 3H4-2H6, purified immunoglobulin rat, human
western blot pricing
SAB5200116 Monoclonal Anti-Trap1 - Atto 488 antibody produced in mouse clone 3H4-2H6, purified immunoglobulin human, rat
western blot pricing
SAB5200117 Monoclonal Anti-Trap1 - Atto 565 antibody produced in mouse clone 3H4-2H6, purified immunoglobulin rat, human
western blot pricing
SAB5200118 Monoclonal Anti-Trap1 - Atto 594 antibody produced in mouse clone 3H4-2H6, purified immunoglobulin rat, human
western blot pricing
SAB5200119 Monoclonal Anti-Trap1 - Atto 633 antibody produced in mouse clone 3H4-2H6, purified immunoglobulin rat, human
western blot pricing
SAB5200120 Monoclonal Anti-Trap1 - Atto 655 antibody produced in mouse clone 3H4-2H6, purified immunoglobulin human, rat
western blot pricing
SAB5200121 Monoclonal Anti-Trap1 - Atto 680 antibody produced in mouse clone 3H4-2H6, purified immunoglobulin rat, human
western blot pricing
SAB5200122 Monoclonal Anti-Trap1 - Atto 700 antibody produced in mouse clone 3H4-2H6, purified immunoglobulin rat, human
western blot pricing
SAB5200125 Monoclonal Anti-Trap1 - Biotin antibody produced in mouse clone 3H4-2H6, purified immunoglobulin rat, human
western blot pricing
SAB5200126 Monoclonal Anti-Trap1 - Fitc antibody produced in mouse clone 3H4-2H6, purified immunoglobulin human, rat
western blot pricing
SAB5200127 Monoclonal Anti-Trap1 - Hrp antibody produced in mouse clone 3H4-2H6, purified immunoglobulin rat, human
western blot pricing
SAB5200128 Monoclonal Anti-Trap1 - PE/Atto 594 antibody produced in mouse clone 3H4-2H6, purified immunoglobulin human, rat
western blot pricing
SAB5200129 Monoclonal Anti-Trap1 - PerCP antibody produced in mouse clone 3H4-2H6, purified immunoglobulin rat, human
western blot pricing
SAB5200130 Monoclonal Anti-Trap1 - RPE antibody produced in mouse clone 3H4-2H6, purified immunoglobulin rat, human
western blot pricing
SAB5200131 Monoclonal Anti-Trap1 - Streptavidin antibody produced in mouse clone 3H4-2H6, purified immunoglobulin rat, human
western blot pricing
SAB5200114 Monoclonal Anti-Trap1 antibody produced in mouse clone 3H4-2H6, purified immunoglobulin rat, human
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_026508 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026508 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026508 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016292 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016292 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016292 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016292 Rosetta Predictions human pricing
NM_001039001 Rosetta Predictions rat pricing
NM_026508 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016292 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00040179 predicted 1119
2 SASI_Hs02_00349214 predicted 707
3 SASI_Hs02_00349215 predicted 822
4 SASI_Hs01_00040180 predicted 464
5 SASI_Hs01_00040182 predicted 1360
6 SASI_Hs02_00349216 predicted 555
7 SASI_Hs01_00040184 predicted 674
8 SASI_Hs01_00040185 predicted 896
9 SASI_Hs01_00040187 predicted 303
10 SASI_Hs01_00040188 predicted 907
11 SASI_Hs01_00040181 predicted 1446
12 SASI_Hs01_00040183 predicted 1008
13 SASI_Hs01_00040186 predicted 1677
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039001 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00049396 predicted 1056
2 SASI_Rn01_00049397 predicted 966
3 SASI_Rn01_00049398 predicted 1554
4 SASI_Rn01_00049399 predicted 842
5 SASI_Rn01_00049401 predicted 444
6 SASI_Rn01_00049402 predicted 935
7 SASI_Rn01_00049403 predicted 1296
8 SASI_Rn01_00049404 predicted 984
9 SASI_Rn01_00049405 predicted 615
10 SASI_Rn02_00204723 predicted 1279
11 SASI_Rn01_00049400 predicted 927
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026508 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00035997 predicted 1042
2 SASI_Mm01_00035998 predicted 1477
3 SASI_Mm01_00035999 predicted 839
4 SASI_Mm01_00036000 predicted 481
5 SASI_Mm01_00036001 predicted 629
6 SASI_Mm01_00036002 predicted 962
7 SASI_Mm01_00036003 predicted 1570
8 SASI_Mm01_00036005 predicted 948
9 SASI_Mm01_00036006 predicted 661
10 SASI_Mm02_00330414 predicted 855
11 SASI_Mm01_00036004 predicted 1066
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026508
VALIDATED
TRAP1 MISSION shRNA Bacterial Glycerol Stock
TNF receptor-associated protein 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000351040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026508.2-670s21c1
Sequence:CCGGGCTGACAAGGTTGAAGTCTATCTCGAGATAGACTTCAACCTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026508.2-981s21c1
Sequence:CCGGCCGTTATATTGCTCAGGCTTACTCGAGTAAGCCTGAGCAATATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026508.2-479s21c1
Sequence:CCGGATGCCAAGAAGGGCACTATTACTCGAGTAATAGTGCCCTTCTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026508.2-894s21c1
Sequence:CCGGCCTTAATGGAAAGCGGATTAACTCGAGTTAATCCGCTTTCCATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026508.2-1557s21c1
Sequence:CCGGGGCTGAACATTCACCCTATTACTCGAGTAATAGGGTGAATGTTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026508.1-981s1c1
Sequence:CCGGCCGTTATATTGCTCAGGCTTACTCGAGTAAGCCTGAGCAATATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026508.1-1407s1c1
Sequence:CCGGGCAAGACATCAAGGAGGATATCTCGAGATATCCTCCTTGATGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026508.1-670s1c1
Sequence:CCGGGCTGACAAGGTTGAAGTCTATCTCGAGATAGACTTCAACCTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026508.1-1786s1c1
Sequence:CCGGGCGTGGATGAGAAATGCACTACTCGAGTAGTGCATTTCTCATCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000112173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026508.1-894s1c1
Sequence:CCGGCCTTAATGGAAAGCGGATTAACTCGAGTTAATCCGCTTTCCATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026508
VALIDATED
TRAP1 MISSION shRNA shRNA Plasmid DNA
TNF receptor-associated protein 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000351040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026508.2-670s21c1
Sequence:CCGGGCTGACAAGGTTGAAGTCTATCTCGAGATAGACTTCAACCTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026508.2-981s21c1
Sequence:CCGGCCGTTATATTGCTCAGGCTTACTCGAGTAAGCCTGAGCAATATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026508.2-479s21c1
Sequence:CCGGATGCCAAGAAGGGCACTATTACTCGAGTAATAGTGCCCTTCTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026508.2-894s21c1
Sequence:CCGGCCTTAATGGAAAGCGGATTAACTCGAGTTAATCCGCTTTCCATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026508.2-1557s21c1
Sequence:CCGGGGCTGAACATTCACCCTATTACTCGAGTAATAGGGTGAATGTTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026508.1-981s1c1
Sequence:CCGGCCGTTATATTGCTCAGGCTTACTCGAGTAAGCCTGAGCAATATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026508.1-1407s1c1
Sequence:CCGGGCAAGACATCAAGGAGGATATCTCGAGATATCCTCCTTGATGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026508.1-670s1c1
Sequence:CCGGGCTGACAAGGTTGAAGTCTATCTCGAGATAGACTTCAACCTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026508.1-1786s1c1
Sequence:CCGGGCGTGGATGAGAAATGCACTACTCGAGTAGTGCATTTCTCATCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000112173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026508.1-894s1c1
Sequence:CCGGCCTTAATGGAAAGCGGATTAACTCGAGTTAATCCGCTTTCCATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026508
VALIDATED
TRAP1 MISSION shRNA Lentiviral Transduction Particles
TNF receptor-associated protein 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000351040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026508.2-670s21c1
Sequence:CCGGGCTGACAAGGTTGAAGTCTATCTCGAGATAGACTTCAACCTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339764    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026508.2-981s21c1
Sequence:CCGGCCGTTATATTGCTCAGGCTTACTCGAGTAAGCCTGAGCAATATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339765    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026508.2-479s21c1
Sequence:CCGGATGCCAAGAAGGGCACTATTACTCGAGTAATAGTGCCCTTCTTGGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339838    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026508.2-894s21c1
Sequence:CCGGCCTTAATGGAAAGCGGATTAACTCGAGTTAATCCGCTTTCCATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339766    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_026508.2-1557s21c1
Sequence:CCGGGGCTGAACATTCACCCTATTACTCGAGTAATAGGGTGAATGTTCAGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112170    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026508.1-981s1c1
Sequence:CCGGCCGTTATATTGCTCAGGCTTACTCGAGTAAGCCTGAGCAATATAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112171    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_026508.1-1407s1c1
Sequence:CCGGGCAAGACATCAAGGAGGATATCTCGAGATATCCTCCTTGATGTCTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112172    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026508.1-670s1c1
Sequence:CCGGGCTGACAAGGTTGAAGTCTATCTCGAGATAGACTTCAACCTTGTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112174    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026508.1-1786s1c1
Sequence:CCGGGCGTGGATGAGAAATGCACTACTCGAGTAGTGCATTTCTCATCCACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000112173    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_026508.1-894s1c1
Sequence:CCGGCCTTAATGGAAAGCGGATTAACTCGAGTTAATCCGCTTTCCATTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016292
VALIDATED
TRAP1 MISSION shRNA Bacterial Glycerol Stock
TNF receptor-associated protein 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000244474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016292.2-1064s21c1
Sequence:CCGGCCGCTACACCCTGCACTATAACTCGAGTTATAGTGCAGGGTGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016292.2-791s21c1
Sequence:CCGGTGGTTCTGGAGTGTTTGAAATCTCGAGATTTCAAACACTCCAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016292.2-1612s21c1
Sequence:CCGGCAGAGCACTCACCCTACTATGCTCGAGCATAGTAGGGTGAGTGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000244473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016292.2-2104s21c1
Sequence:CCGGTATACGAGAACGCCATGATTGCTCGAGCAATCATGGCGTTCTCGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016292.1-1042s1c1
Sequence:CCGGCGACATGAAACCGTCCATGTTCTCGAGAACATGGACGGTTTCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016292.1-1949s1c1
Sequence:CCGGGCGCTCATCAAGAAGCTGAATCTCGAGATTCAGCTTCTTGATGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016292.1-587s1c1
Sequence:CCGGAGCAAGATCATCGGCCAGTTTCTCGAGAAACTGGCCGATGATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016292
VALIDATED
TRAP1 MISSION shRNA shRNA Plasmid DNA
TNF receptor-associated protein 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000244474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016292.2-1064s21c1
Sequence:CCGGCCGCTACACCCTGCACTATAACTCGAGTTATAGTGCAGGGTGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016292.2-791s21c1
Sequence:CCGGTGGTTCTGGAGTGTTTGAAATCTCGAGATTTCAAACACTCCAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016292.2-1612s21c1
Sequence:CCGGCAGAGCACTCACCCTACTATGCTCGAGCATAGTAGGGTGAGTGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000244473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016292.2-2104s21c1
Sequence:CCGGTATACGAGAACGCCATGATTGCTCGAGCAATCATGGCGTTCTCGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016292.1-1042s1c1
Sequence:CCGGCGACATGAAACCGTCCATGTTCTCGAGAACATGGACGGTTTCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016292.1-1949s1c1
Sequence:CCGGGCGCTCATCAAGAAGCTGAATCTCGAGATTCAGCTTCTTGATGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016292.1-587s1c1
Sequence:CCGGAGCAAGATCATCGGCCAGTTTCTCGAGAAACTGGCCGATGATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016292
VALIDATED
TRAP1 MISSION shRNA Lentiviral Transduction Particles
TNF receptor-associated protein 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000244474    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 2 Clone ID:NM_016292.2-1064s21c1
Sequence:CCGGCCGCTACACCCTGCACTATAACTCGAGTTATAGTGCAGGGTGTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244241    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016292.2-791s21c1
Sequence:CCGGTGGTTCTGGAGTGTTTGAAATCTCGAGATTTCAAACACTCCAGAACCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244240    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_016292.2-1612s21c1
Sequence:CCGGCAGAGCACTCACCCTACTATGCTCGAGCATAGTAGGGTGAGTGCTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000244473    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: A549
TRC Version: 2 Clone ID:NM_016292.2-2104s21c1
Sequence:CCGGTATACGAGAACGCCATGATTGCTCGAGCAATCATGGCGTTCTCGTATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060673    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016292.1-1042s1c1
Sequence:CCGGCGACATGAAACCGTCCATGTTCTCGAGAACATGGACGGTTTCATGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: A549
TRC Version: 1 Clone ID:NM_016292.1-1949s1c1
Sequence:CCGGGCGCTCATCAAGAAGCTGAATCTCGAGATTCAGCTTCTTGATGAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_016292.1-587s1c1
Sequence:CCGGAGCAAGATCATCGGCCAGTTTCTCGAGAAACTGGCCGATGATCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks