EMAIL THIS PAGE TO A FRIEND

TRAPPC10

trafficking protein particle complex 10

Synonyms: EHOC-1 EHOC1 GT334 TMEM1 TRS130 TRS30
UniProtKB ID: P48553, Q3MIR2, Q9UMD4, Q9Y4L3
Gene ID:
Human(7109) Summary: The protein encoded by this gene is a transmembrane protein found in the cis-Golgi complex. The encoded protein is part of the multisubunit transport protein particle (TRAPP) complex and may be involved in vesicular transport from the endoplasmic reticulum to the Golgi. Mutations in this gene could be responsible for the Unverricht-Lundborg type of progressive myoclonus epilepsy, or for autoimmune polyglandular disease type 1. [provided by RefSeq, Jul 2008]
Mouse(216131) trafficking protein particle complex 10
Rat(309678) trafficking protein particle complex 10
Zebrafish(100334988) trafficking protein particle complex 10
chicken(771556) trafficking protein particle complex 10
domestic cat(101092285) trafficking protein particle complex 10
dog(487789) trafficking protein particle complex 10
naked mole-rat(101697059) trafficking protein particle complex 10
Domestic Rabbit(100358151) trafficking protein particle complex 10
domestic guinea pig(100728773) trafficking protein particle complex 10
cow(521387) trafficking protein particle complex 10
sheep(101107491) trafficking protein particle complex 10
169 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001001723 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001001723 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001001723 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001081055 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001081055 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001081055 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001001723 Rosetta Predictions human pricing
NM_003274 Rosetta Predictions human pricing
XM_001079323 Rosetta Predictions rat pricing
XM_228065 Rosetta Predictions rat pricing
NM_001081055 Rosetta Predictions mouse pricing
XM_125775 Rosetta Predictions mouse pricing
XM_899494 Rosetta Predictions mouse pricing
XM_899506 Rosetta Predictions mouse pricing
XM_899513 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001001723 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00198449 predicted 359
2 SASI_Hs01_00198450 predicted 1259
3 SASI_Hs01_00198451 predicted 932
4 SASI_Hs01_00198452 predicted 1084
5 SASI_Hs01_00198453 predicted 1250
6 SASI_Hs01_00198454 predicted 1207
7 SASI_Hs01_00198455 predicted 824
8 SASI_Hs01_00198456 predicted 452
9 SASI_Hs01_00198457 predicted 530
10 SASI_Hs01_00198458 predicted 1002
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003274 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00066457 predicted 2785
2 SASI_Hs01_00066458 predicted 3304
3 SASI_Hs01_00066459 predicted 1074
4 SASI_Hs01_00066460 predicted 988
5 SASI_Hs02_00335332 predicted 2149
6 SASI_Hs01_00066461 predicted 3090
7 SASI_Hs01_00066462 predicted 2417
8 SASI_Hs01_00066463 predicted 2110
9 SASI_Hs02_00335333 predicted 825
10 SASI_Hs01_00066465 predicted 1349
11 SASI_Hs01_00066464 predicted 452
12 SASI_Hs01_00066466 predicted 356
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001079323 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00363989 predicted 2939
2 SASI_Rn02_00363990 predicted 2712
3 SASI_Rn02_00363991 predicted 1432
4 SASI_Rn02_00363992 predicted 2855
5 SASI_Rn02_00363993 predicted 1895
6 SASI_Rn02_00363994 predicted 2373
7 SASI_Rn02_00363995 predicted 1451
8 SASI_Rn02_00363996 predicted 1533
9 SASI_Rn02_00363997 predicted 1482
10 SASI_Rn02_00363998 predicted 3044
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_228065 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00384891 predicted 2935
2 SASI_Rn02_00384892 predicted 2709
3 SASI_Rn02_00384893 predicted 1432
4 SASI_Rn02_00384894 predicted 2855
5 SASI_Rn02_00384895 predicted 1899
6 SASI_Rn02_00384896 predicted 2372
7 SASI_Rn02_00384897 predicted 1447
8 SASI_Rn02_00384898 predicted 1531
9 SASI_Rn02_00384899 predicted 1480
10 SASI_Rn02_00384900 predicted 3043
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001081055 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00294731 predicted 3324
2 SASI_Mm02_00294732 predicted 2708
3 SASI_Mm02_00294733 predicted 285
4 SASI_Mm02_00294734 predicted 1768
5 SASI_Mm02_00294735 predicted 900
6 SASI_Mm02_00294736 predicted 2937
7 SASI_Mm02_00294737 predicted 2557
8 SASI_Mm02_00294738 predicted 797
9 SASI_Mm02_00294739 predicted 2078
10 SASI_Mm02_00294740 predicted 3273
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_125775 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00242399 predicted 3328
2 SASI_Mm01_00242400 predicted 2714
3 SASI_Mm01_00242401 predicted 291
4 SASI_Mm01_00242402 predicted 1783
5 SASI_Mm01_00242403 predicted 2946
6 SASI_Mm01_00242404 predicted 2554
7 SASI_Mm01_00242405 predicted 798
8 SASI_Mm01_00242406 predicted 2076
9 SASI_Mm01_00242407 predicted 3276
10 SASI_Mm01_00242408 predicted 3051
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899494 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00270358 predicted 2088
2 SASI_Mm01_00270359 predicted 1981
3 SASI_Mm01_00270360 predicted 1813
4 SASI_Mm01_00270361 predicted 1512
5 SASI_Mm01_00270362 predicted 1941
6 SASI_Mm01_00270363 predicted 2667
7 SASI_Mm01_00270364 predicted 2328
8 SASI_Mm01_00270365 predicted 1527
9 SASI_Mm01_00270366 predicted 2683
10 SASI_Mm01_00270367 predicted 1950
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899506 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00207688 predicted 288
2 SASI_Mm01_00207689 predicted 803
3 SASI_Mm01_00207690 predicted 316
4 SASI_Mm01_00207691 predicted 821
5 SASI_Mm01_00207692 predicted 823
6 SASI_Mm01_00207693 predicted 309
7 SASI_Mm01_00207694 predicted 822
8 SASI_Mm01_00207695 predicted 830
9 SASI_Mm01_00207696 predicted 789
10 SASI_Mm01_00207697 predicted 267
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_899513 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00227533 predicted 292
2 SASI_Mm01_00227534 predicted 318
3 SASI_Mm01_00227535 predicted 316
4 SASI_Mm01_00227536 predicted 310
5 SASI_Mm01_00227537 predicted 275
6 SASI_Mm01_00227538 predicted 269
7 SASI_Mm01_00227539 predicted 293
8 SASI_Mm01_00227540 predicted 316
9 SASI_Mm01_00227541 predicted 265
10 SASI_Mm01_00227542 predicted 285
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001001723
VALIDATED
TRAPPC10 MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 10
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001723.1-1490s1c1
Sequence:CCGGCCATGTGTGAAGGAAGGAGTACTCGAGTACTCCTTCCTTCACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001723.1-595s1c1
Sequence:CCGGCCGAACCTCTATTGTGGACAACTCGAGTTGTCCACAATAGAGGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001723.1-450s1c1
Sequence:CCGGGCTGTGATACCGAAGTGTATACTCGAGTATACACTTCGGTATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001723.1-234s1c1
Sequence:CCGGCCTGTGCTGGAGATCAGAATTCTCGAGAATTCTGATCTCCAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001723.1-332s1c1
Sequence:CCGGGCTCCGAAGATGATTCACCTACTCGAGTAGGTGAATCATCTTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001001723
VALIDATED
TRAPPC10 MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 10
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001723.1-1490s1c1
Sequence:CCGGCCATGTGTGAAGGAAGGAGTACTCGAGTACTCCTTCCTTCACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001723.1-595s1c1
Sequence:CCGGCCGAACCTCTATTGTGGACAACTCGAGTTGTCCACAATAGAGGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001723.1-450s1c1
Sequence:CCGGGCTGTGATACCGAAGTGTATACTCGAGTATACACTTCGGTATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001723.1-234s1c1
Sequence:CCGGCCTGTGCTGGAGATCAGAATTCTCGAGAATTCTGATCTCCAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001723.1-332s1c1
Sequence:CCGGGCTCCGAAGATGATTCACCTACTCGAGTAGGTGAATCATCTTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001001723
VALIDATED
TRAPPC10 MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 10
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060043    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_001001723.1-1490s1c1
Sequence:CCGGCCATGTGTGAAGGAAGGAGTACTCGAGTACTCCTTCCTTCACACATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060044    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001723.1-595s1c1
Sequence:CCGGCCGAACCTCTATTGTGGACAACTCGAGTTGTCCACAATAGAGGTTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060046    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001723.1-450s1c1
Sequence:CCGGGCTGTGATACCGAAGTGTATACTCGAGTATACACTTCGGTATCACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001723.1-234s1c1
Sequence:CCGGCCTGTGCTGGAGATCAGAATTCTCGAGAATTCTGATCTCCAGCACAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060045    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: A549
TRC Version: 1 Clone ID:NM_001001723.1-332s1c1
Sequence:CCGGGCTCCGAAGATGATTCACCTACTCGAGTAGGTGAATCATCTTCGGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001081055
VALIDATED
TRAPPC10 MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 10
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081055.1-3707s21c1
Sequence:CCGGAGTGGACAAGCACCTAGATGACTCGAGTCATCTAGGTGCTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081055.1-4834s21c1
Sequence:CCGGACCGCACCAACGGGTTCATTTCTCGAGAAATGAACCCGTTGGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081055.1-3485s21c1
Sequence:CCGGTGTGGACAACAGCAGCAATTGCTCGAGCAATTGCTGCTGTTGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081055.1-3673s21c1
Sequence:CCGGATGCTGACAGCTGGATAGAAACTCGAGTTTCTATCCAGCTGTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081055.1-3428s21c1
Sequence:CCGGGGATGAAGCACTCGTGGAATCCTCGAGGATTCCACGAGTGCTTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001081055
VALIDATED
TRAPPC10 MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 10
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081055.1-3707s21c1
Sequence:CCGGAGTGGACAAGCACCTAGATGACTCGAGTCATCTAGGTGCTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081055.1-4834s21c1
Sequence:CCGGACCGCACCAACGGGTTCATTTCTCGAGAAATGAACCCGTTGGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081055.1-3485s21c1
Sequence:CCGGTGTGGACAACAGCAGCAATTGCTCGAGCAATTGCTGCTGTTGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081055.1-3673s21c1
Sequence:CCGGATGCTGACAGCTGGATAGAAACTCGAGTTTCTATCCAGCTGTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081055.1-3428s21c1
Sequence:CCGGGGATGAAGCACTCGTGGAATCCTCGAGGATTCCACGAGTGCTTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001081055
VALIDATED
TRAPPC10 MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 10
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252383    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081055.1-3707s21c1
Sequence:CCGGAGTGGACAAGCACCTAGATGACTCGAGTCATCTAGGTGCTTGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252385    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.79 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081055.1-4834s21c1
Sequence:CCGGACCGCACCAACGGGTTCATTTCTCGAGAAATGAACCCGTTGGTGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252387    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.8 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081055.1-3485s21c1
Sequence:CCGGTGTGGACAACAGCAGCAATTGCTCGAGCAATTGCTGCTGTTGTCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252386    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081055.1-3673s21c1
Sequence:CCGGATGCTGACAGCTGGATAGAAACTCGAGTTTCTATCCAGCTGTCAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252384    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: 3T3-L1
TRC Version: 2 Clone ID:NM_001081055.1-3428s21c1
Sequence:CCGGGGATGAAGCACTCGTGGAATCCTCGAGGATTCCACGAGTGCTTCATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks