EMAIL THIS PAGE TO A FRIEND

TRAPPC11

trafficking protein particle complex 11

Synonyms: C4orf41 FOIGR GRY LGMD2S
Gene ID:
Human(60684) Summary: The protein encoded by this gene is a subunit of the TRAPP (transport protein particle) tethering complex, which functions in intracellular vesicle trafficking. This subunit is involved in early stage endoplasmic reticulum-to-Golgi vesicle transport. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Jan 2013]
Mouse(320714) trafficking protein particle complex 11
Rat(290746) trafficking protein particle complex 11
cow(537211) trafficking protein particle complex 11
sheep(101109589) trafficking protein particle complex 11
domestic guinea pig(100721795) trafficking protein particle complex 11
naked mole-rat(101699121) trafficking protein particle complex 11
Zebrafish(323003) trafficking protein particle complex 11
domestic cat(101088831) trafficking protein particle complex 11
dog(482914) trafficking protein particle complex 11
91 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302370 ANTI-CD041 (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021942 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021942 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021942 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_177240 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_177240 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_177240 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021942 Rosetta Predictions human pricing
NM_199053 Rosetta Predictions human pricing
XM_001059837 Rosetta Predictions rat pricing
XM_224848 Rosetta Predictions rat pricing
NM_177240 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021942 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00078372 predicted 1043
2 SASI_Hs02_00355257 predicted 2375
3 SASI_Hs01_00078373 predicted 1534
4 SASI_Hs02_00355258 predicted 1416
5 SASI_Hs01_00078376 predicted 1320
6 SASI_Hs02_00355259 predicted 2437
7 SASI_Hs01_00078377 predicted 1716
8 SASI_Hs01_00078378 predicted 1113
9 SASI_Hs01_00078379 predicted 1556
10 SASI_Hs02_00355260 predicted 1197
11 SASI_Hs01_00078374 predicted 1457
12 SASI_Hs01_00078375 predicted 941
13 SASI_Hs01_00078380 predicted 2319
14 SASI_Hs01_00078381 predicted 1044
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_199053 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00182282 predicted 1044
2 SASI_Hs02_00372543 predicted 2374
3 SASI_Hs01_00182283 predicted 1535
4 SASI_Hs02_00372544 predicted 1414
5 SASI_Hs01_00182286 predicted 1323
6 SASI_Hs02_00372545 predicted 2438
7 SASI_Hs01_00182287 predicted 1719
8 SASI_Hs01_00182288 predicted 1109
9 SASI_Hs01_00182289 predicted 1549
10 SASI_Hs02_00372546 predicted 1200
11 SASI_Hs01_00182284 predicted 1464
12 SASI_Hs01_00182285 predicted 947
13 SASI_Hs01_00182290 predicted 2327
14 SASI_Hs01_00182291 predicted 1038
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059837 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00294517 predicted 1209
2 SASI_Rn02_00294518 predicted 968
3 SASI_Rn02_00294519 predicted 1618
4 SASI_Rn02_00294520 predicted 1102
5 SASI_Rn02_00294521 predicted 973
6 SASI_Rn02_00294522 predicted 2653
7 SASI_Rn02_00294523 predicted 2954
8 SASI_Rn02_00294524 predicted 2149
9 SASI_Rn02_00294525 predicted 376
10 SASI_Rn02_00294526 predicted 3538
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_224848 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00382316 predicted 1207
2 SASI_Rn02_00382317 predicted 965
3 SASI_Rn02_00382318 predicted 1621
4 SASI_Rn02_00382319 predicted 1095
5 SASI_Rn02_00382320 predicted 974
6 SASI_Rn02_00382321 predicted 2660
7 SASI_Rn02_00382322 predicted 2951
8 SASI_Rn02_00382323 predicted 2152
9 SASI_Rn02_00382324 predicted 380
10 SASI_Rn02_00382325 predicted 3542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177240 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00079730 predicted 2380
2 SASI_Mm01_00079731 predicted 1669
3 SASI_Mm01_00079732 predicted 1972
4 SASI_Mm01_00079733 predicted 834
5 SASI_Mm01_00079734 predicted 1318
6 SASI_Mm01_00079735 predicted 3227
7 SASI_Mm01_00079736 predicted 936
8 SASI_Mm01_00079737 predicted 1437
9 SASI_Mm02_00347279 predicted 2462
10 SASI_Mm02_00347280 predicted 545
11 SASI_Mm01_00079729 predicted 796
12 SASI_Mm01_00079738 predicted 2172
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021942
TRAPPC11 MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 11
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000430768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021942.4-400s21c1
Sequence:CCGGACATTCCTAAAGGGATCTTAACTCGAGTTAAGATCCCTTTAGGAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021942.4-711s21c1
Sequence:CCGGGACCACCTTGTGGGTTATATTCTCGAGAATATAACCCACAAGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021942.4-1684s21c1
Sequence:CCGGCCTACCTCATGGCCCAATTAACTCGAGTTAATTGGGCCATGAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021942.4-3694s21c1
Sequence:CCGGATGGATGTTATACCAACTATTCTCGAGAATAGTTGGTATAACATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021942.4-3392s21c1
Sequence:CCGGGGAGCAGGAAATGCTATATAACTCGAGTTATATAGCATTTCCTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000138655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021942.4-2041s1c1
Sequence:CCGGCCAAGCTCTGTGTCAGCTTTACTCGAGTAAAGCTGACACAGAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021942.4-3281s1c1
Sequence:CCGGCCTACAGAATAAGACCGACTTCTCGAGAAGTCGGTCTTATTCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021942.4-2835s1c1
Sequence:CCGGCCATTTGATGTTGCGGTTAAACTCGAGTTTAACCGCAACATCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000133996    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021942.4-3794s1c1
Sequence:CCGGCATGAAAGAATGTCAGACCATCTCGAGATGGTCTGACATTCTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021942.4-1363s1c1
Sequence:CCGGCATGGCGACAAGGAATACTAACTCGAGTTAGTATTCCTTGTCGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021942.4-3939s1c1
Sequence:CCGGCCTGTGCCATAAAGTTCCGAACTCGAGTTCGGAACTTTATGGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021942.4-3443s1c1
Sequence:CCGGGCTGCCATCTCTCAACATCAACTCGAGTTGATGTTGAGAGATGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021942
TRAPPC11 MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 11
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000430768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021942.4-400s21c1
Sequence:CCGGACATTCCTAAAGGGATCTTAACTCGAGTTAAGATCCCTTTAGGAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021942.4-711s21c1
Sequence:CCGGGACCACCTTGTGGGTTATATTCTCGAGAATATAACCCACAAGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021942.4-1684s21c1
Sequence:CCGGCCTACCTCATGGCCCAATTAACTCGAGTTAATTGGGCCATGAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021942.4-3694s21c1
Sequence:CCGGATGGATGTTATACCAACTATTCTCGAGAATAGTTGGTATAACATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021942.4-3392s21c1
Sequence:CCGGGGAGCAGGAAATGCTATATAACTCGAGTTATATAGCATTTCCTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000138655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021942.4-2041s1c1
Sequence:CCGGCCAAGCTCTGTGTCAGCTTTACTCGAGTAAAGCTGACACAGAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021942.4-3281s1c1
Sequence:CCGGCCTACAGAATAAGACCGACTTCTCGAGAAGTCGGTCTTATTCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021942.4-2835s1c1
Sequence:CCGGCCATTTGATGTTGCGGTTAAACTCGAGTTTAACCGCAACATCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000133996    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021942.4-3794s1c1
Sequence:CCGGCATGAAAGAATGTCAGACCATCTCGAGATGGTCTGACATTCTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021942.4-1363s1c1
Sequence:CCGGCATGGCGACAAGGAATACTAACTCGAGTTAGTATTCCTTGTCGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021942.4-3939s1c1
Sequence:CCGGCCTGTGCCATAAAGTTCCGAACTCGAGTTCGGAACTTTATGGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021942.4-3443s1c1
Sequence:CCGGGCTGCCATCTCTCAACATCAACTCGAGTTGATGTTGAGAGATGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021942
TRAPPC11 MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 11
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000430768    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021942.4-400s21c1
Sequence:CCGGACATTCCTAAAGGGATCTTAACTCGAGTTAAGATCCCTTTAGGAATGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423814    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021942.4-711s21c1
Sequence:CCGGGACCACCTTGTGGGTTATATTCTCGAGAATATAACCCACAAGGTGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427882    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021942.4-1684s21c1
Sequence:CCGGCCTACCTCATGGCCCAATTAACTCGAGTTAATTGGGCCATGAGGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414791    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021942.4-3694s21c1
Sequence:CCGGATGGATGTTATACCAACTATTCTCGAGAATAGTTGGTATAACATCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021942.4-3392s21c1
Sequence:CCGGGGAGCAGGAAATGCTATATAACTCGAGTTATATAGCATTTCCTGCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000138655    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021942.4-2041s1c1
Sequence:CCGGCCAAGCTCTGTGTCAGCTTTACTCGAGTAAAGCTGACACAGAGCTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136794    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021942.4-3281s1c1
Sequence:CCGGCCTACAGAATAAGACCGACTTCTCGAGAAGTCGGTCTTATTCTGTAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021942.4-2835s1c1
Sequence:CCGGCCATTTGATGTTGCGGTTAAACTCGAGTTTAACCGCAACATCAAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000133996    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_021942.4-3794s1c1
Sequence:CCGGCATGAAAGAATGTCAGACCATCTCGAGATGGTCTGACATTCTTTCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136759    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021942.4-1363s1c1
Sequence:CCGGCATGGCGACAAGGAATACTAACTCGAGTTAGTATTCCTTGTCGCCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137879    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021942.4-3939s1c1
Sequence:CCGGCCTGTGCCATAAAGTTCCGAACTCGAGTTCGGAACTTTATGGCACAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137734    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021942.4-3443s1c1
Sequence:CCGGGCTGCCATCTCTCAACATCAACTCGAGTTGATGTTGAGAGATGGCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177240
VALIDATED
TRAPPC11 MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 11
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000198639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177240.2-832s1c1
Sequence:CCGGCAGAGTCCCAAACATCTCTGTCTCGAGACAGAGATGTTTGGGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000198047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177240.2-826s1c1
Sequence:CCGGCATTTCCAGAGTCCCAAACATCTCGAGATGTTTGGGACTCTGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177240.2-634s1c1
Sequence:CCGGGATCACCTCTGTGGATCTGTTCTCGAGAACAGATCCACAGAGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177240.2-977s1c1
Sequence:CCGGCATCCACTTTATAAGTTCCTACTCGAGTAGGAACTTATAAAGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000176547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177240.2-878s1c1
Sequence:CCGGCTAATGAATGAGATGTACTGTCTCGAGACAGTACATCTCATTCATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177240
VALIDATED
TRAPPC11 MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 11
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000198639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177240.2-832s1c1
Sequence:CCGGCAGAGTCCCAAACATCTCTGTCTCGAGACAGAGATGTTTGGGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000198047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177240.2-826s1c1
Sequence:CCGGCATTTCCAGAGTCCCAAACATCTCGAGATGTTTGGGACTCTGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177240.2-634s1c1
Sequence:CCGGGATCACCTCTGTGGATCTGTTCTCGAGAACAGATCCACAGAGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177240.2-977s1c1
Sequence:CCGGCATCCACTTTATAAGTTCCTACTCGAGTAGGAACTTATAAAGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000176547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177240.2-878s1c1
Sequence:CCGGCTAATGAATGAGATGTACTGTCTCGAGACAGTACATCTCATTCATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177240
VALIDATED
TRAPPC11 MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 11
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000198639    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177240.2-832s1c1
Sequence:CCGGCAGAGTCCCAAACATCTCTGTCTCGAGACAGAGATGTTTGGGACTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000198047    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177240.2-826s1c1
Sequence:CCGGCATTTCCAGAGTCCCAAACATCTCGAGATGTTTGGGACTCTGGAAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181870    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177240.2-634s1c1
Sequence:CCGGGATCACCTCTGTGGATCTGTTCTCGAGAACAGATCCACAGAGGTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176576    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177240.2-977s1c1
Sequence:CCGGCATCCACTTTATAAGTTCCTACTCGAGTAGGAACTTATAAAGTGGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000176547    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_177240.2-878s1c1
Sequence:CCGGCTAATGAATGAGATGTACTGTCTCGAGACAGTACATCTCATTCATTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks