EMAIL THIS PAGE TO A FRIEND

TRAPPC12

trafficking protein particle complex 12

Synonyms: TTC-15 TTC15
UniProtKB ID: Q8WVT3, B3KV01, D6W4Y2, Q8WVW1, Q9Y395
Gene ID:
Mouse(217449) trafficking protein particle complex 12
Rat(314013) trafficking protein particle complex 12
Zebrafish(791162) trafficking protein particle complex 12
chicken(421917) trafficking protein particle complex 12
domestic cat(101097967) trafficking protein particle complex 12
naked mole-rat(101715802) trafficking protein particle complex 12
domestic guinea pig(100725892) trafficking protein particle complex 12
sheep(101113733) trafficking protein particle complex 12
60 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_178811 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_178811 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_178811 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016030 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016030 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016030 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016030 Rosetta Predictions human pricing
XM_001071807 Rosetta Predictions rat pricing
XM_234029 Rosetta Predictions rat pricing
NM_178811 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016030 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00348736 predicted 1860
2 SASI_Hs01_00028166 predicted 1302
3 SASI_Hs01_00028167 predicted 1550
4 SASI_Hs01_00028168 predicted 1566
5 SASI_Hs01_00028169 predicted 2276
6 SASI_Hs01_00028170 predicted 1362
7 SASI_Hs01_00028171 predicted 305
8 SASI_Hs01_00028172 predicted 1572
9 SASI_Hs01_00028173 predicted 1236
10 SASI_Hs02_00348737 predicted 1916
11 SASI_Hs01_00028165 predicted 1735
12 SASI_Hs01_00028174 predicted 1476
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001071807 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00336531 predicted 1664
2 SASI_Rn02_00336532 predicted 321
3 SASI_Rn02_00336533 predicted 2000
4 SASI_Rn02_00336534 predicted 931
5 SASI_Rn02_00336535 predicted 1423
6 SASI_Rn02_00336536 predicted 329
7 SASI_Rn02_00336537 predicted 1099
8 SASI_Rn02_00336538 predicted 1762
9 SASI_Rn02_00336539 predicted 2561
10 SASI_Rn02_00336540 predicted 2469
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_234029 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00388214 predicted 1659
2 SASI_Rn02_00388215 predicted 324
3 SASI_Rn02_00388216 predicted 1999
4 SASI_Rn02_00388217 predicted 936
5 SASI_Rn02_00388218 predicted 1417
6 SASI_Rn02_00388219 predicted 328
7 SASI_Rn02_00388220 predicted 1103
8 SASI_Rn02_00388221 predicted 1766
9 SASI_Rn02_00388222 predicted 2557
10 SASI_Rn02_00388223 predicted 2468
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178811 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00115666 predicted 1791
2 SASI_Mm01_00115667 predicted 431
3 SASI_Mm01_00115668 predicted 1033
4 SASI_Mm01_00115669 predicted 807
5 SASI_Mm01_00115670 predicted 1960
6 SASI_Mm01_00115671 predicted 1200
7 SASI_Mm02_00349410 predicted 658
8 SASI_Mm01_00115672 predicted 2280
9 SASI_Mm01_00115673 predicted 788
10 SASI_Mm01_00115674 predicted 1950
11 SASI_Mm01_00115665 predicted 444
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178811
VALIDATED
TRAPPC12 MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 12
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000192567    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178811.3-2806s1c1
Sequence:CCGGGCATTCAGAAACAGGGAACATCTCGAGATGTTCCCTGTTTCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000216448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178811.3-1021s1c1
Sequence:CCGGGGAGATACAATGAGCTCTAATCTCGAGATTAGAGCTCATTGTATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178811.3-426s21c1
Sequence:CCGGGTCTCACAACTTCGGAGATAACTCGAGTTATCTCCGAAGTTGTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178811.3-1524s21c1
Sequence:CCGGAGCAAAGAGACAGGTCTTAAACTCGAGTTTAAGACCTGTCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178811.3-914s21c1
Sequence:CCGGTCGAGTCCCAGATGGTGAAATCTCGAGATTTCACCATCTGGGACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178811.3-1790s21c1
Sequence:CCGGATCAACCAGACCTATACTATGCTCGAGCATAGTATAGGTCTGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178811.3-2780s21c1
Sequence:CCGGGTTGGTGAAGGTGAGCCATATCTCGAGATATGGCTCACCTTCACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178811
VALIDATED
TRAPPC12 MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 12
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000192567    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178811.3-2806s1c1
Sequence:CCGGGCATTCAGAAACAGGGAACATCTCGAGATGTTCCCTGTTTCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000216448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178811.3-1021s1c1
Sequence:CCGGGGAGATACAATGAGCTCTAATCTCGAGATTAGAGCTCATTGTATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178811.3-426s21c1
Sequence:CCGGGTCTCACAACTTCGGAGATAACTCGAGTTATCTCCGAAGTTGTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178811.3-1524s21c1
Sequence:CCGGAGCAAAGAGACAGGTCTTAAACTCGAGTTTAAGACCTGTCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178811.3-914s21c1
Sequence:CCGGTCGAGTCCCAGATGGTGAAATCTCGAGATTTCACCATCTGGGACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178811.3-1790s21c1
Sequence:CCGGATCAACCAGACCTATACTATGCTCGAGCATAGTATAGGTCTGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178811.3-2780s21c1
Sequence:CCGGGTTGGTGAAGGTGAGCCATATCTCGAGATATGGCTCACCTTCACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178811
VALIDATED
TRAPPC12 MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 12
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000192567    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_178811.3-2806s1c1
Sequence:CCGGGCATTCAGAAACAGGGAACATCTCGAGATGTTCCCTGTTTCTGAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000216448    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_178811.3-1021s1c1
Sequence:CCGGGGAGATACAATGAGCTCTAATCTCGAGATTAGAGCTCATTGTATCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178811.3-426s21c1
Sequence:CCGGGTCTCACAACTTCGGAGATAACTCGAGTTATCTCCGAAGTTGTGAGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178811.3-1524s21c1
Sequence:CCGGAGCAAAGAGACAGGTCTTAAACTCGAGTTTAAGACCTGTCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248991    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178811.3-914s21c1
Sequence:CCGGTCGAGTCCCAGATGGTGAAATCTCGAGATTTCACCATCTGGGACTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248990    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178811.3-1790s21c1
Sequence:CCGGATCAACCAGACCTATACTATGCTCGAGCATAGTATAGGTCTGGTTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257851    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_178811.3-2780s21c1
Sequence:CCGGGTTGGTGAAGGTGAGCCATATCTCGAGATATGGCTCACCTTCACCAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016030
TRAPPC12 MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 12
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000137444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016030.5-1743s1c1
Sequence:CCGGGCCAATTTGGAGCAAGGCTTACTCGAGTAAGCCTTGCTCCAAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016030.5-2132s1c1
Sequence:CCGGCTTCACAGAGATCTTAAGGATCTCGAGATCCTTAAGATCTCTGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000134971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016030.5-1530s1c1
Sequence:CCGGCAGAATGCTGAGATGGAATTTCTCGAGAAATTCCATCTCAGCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016030.5-2123s1c1
Sequence:CCGGCCACAGGTTCTTCACAGAGATCTCGAGATCTCTGTGAAGAACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016030.5-389s1c1
Sequence:CCGGGCTGAACGAACACATGATGGACTCGAGTCCATCATGTGTTCGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016030.5-2288s1c1
Sequence:CCGGCTTCAACCTGACCACCATGTACTCGAGTACATGGTGGTCAGGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016030.5-1874s1c1
Sequence:CCGGCCTGATGAAGGATTATGTGCTCTCGAGAGCACATAATCCTTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000136932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016030.5-300s1c1
Sequence:CCGGCAGGAGGAAACCATCGATCTTCTCGAGAAGATCGATGGTTTCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000137445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016030.5-897s1c1
Sequence:CCGGGCCTTCATTTCCGTCAGCAATCTCGAGATTGCTGACGGAAATGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000454928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016030.5-1305s21c1
Sequence:CCGGGCAAAGAGACAAGTCCTAAATCTCGAGATTTAGGACTTGTCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016030.5-2090s21c1
Sequence:CCGGCCTTCACCTCGGGCAGAATAACTCGAGTTATTCTGCCCGAGGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016030.5-1565s21c1
Sequence:CCGGTCTTGATCAGCCAGATCTTTACTCGAGTAAAGATCTGGCTGATCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016030.5-1909s21c1
Sequence:CCGGATCATTCGGTTATCAAGTATTCTCGAGAATACTTGATAACCGAATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016030
TRAPPC12 MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 12
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000137444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016030.5-1743s1c1
Sequence:CCGGGCCAATTTGGAGCAAGGCTTACTCGAGTAAGCCTTGCTCCAAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016030.5-2132s1c1
Sequence:CCGGCTTCACAGAGATCTTAAGGATCTCGAGATCCTTAAGATCTCTGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000134971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016030.5-1530s1c1
Sequence:CCGGCAGAATGCTGAGATGGAATTTCTCGAGAAATTCCATCTCAGCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016030.5-2123s1c1
Sequence:CCGGCCACAGGTTCTTCACAGAGATCTCGAGATCTCTGTGAAGAACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016030.5-389s1c1
Sequence:CCGGGCTGAACGAACACATGATGGACTCGAGTCCATCATGTGTTCGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016030.5-2288s1c1
Sequence:CCGGCTTCAACCTGACCACCATGTACTCGAGTACATGGTGGTCAGGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016030.5-1874s1c1
Sequence:CCGGCCTGATGAAGGATTATGTGCTCTCGAGAGCACATAATCCTTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000136932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016030.5-300s1c1
Sequence:CCGGCAGGAGGAAACCATCGATCTTCTCGAGAAGATCGATGGTTTCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000137445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016030.5-897s1c1
Sequence:CCGGGCCTTCATTTCCGTCAGCAATCTCGAGATTGCTGACGGAAATGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000454928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016030.5-1305s21c1
Sequence:CCGGGCAAAGAGACAAGTCCTAAATCTCGAGATTTAGGACTTGTCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016030.5-2090s21c1
Sequence:CCGGCCTTCACCTCGGGCAGAATAACTCGAGTTATTCTGCCCGAGGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016030.5-1565s21c1
Sequence:CCGGTCTTGATCAGCCAGATCTTTACTCGAGTAAAGATCTGGCTGATCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016030.5-1909s21c1
Sequence:CCGGATCATTCGGTTATCAAGTATTCTCGAGAATACTTGATAACCGAATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016030
TRAPPC12 MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 12
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000137444    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016030.5-1743s1c1
Sequence:CCGGGCCAATTTGGAGCAAGGCTTACTCGAGTAAGCCTTGCTCCAAATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134866    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016030.5-2132s1c1
Sequence:CCGGCTTCACAGAGATCTTAAGGATCTCGAGATCCTTAAGATCTCTGTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000134971    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016030.5-1530s1c1
Sequence:CCGGCAGAATGCTGAGATGGAATTTCTCGAGAAATTCCATCTCAGCATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136810    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016030.5-2123s1c1
Sequence:CCGGCCACAGGTTCTTCACAGAGATCTCGAGATCTCTGTGAAGAACCTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137171    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016030.5-389s1c1
Sequence:CCGGGCTGAACGAACACATGATGGACTCGAGTCCATCATGTGTTCGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137130    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016030.5-2288s1c1
Sequence:CCGGCTTCAACCTGACCACCATGTACTCGAGTACATGGTGGTCAGGTTGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136321    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016030.5-1874s1c1
Sequence:CCGGCCTGATGAAGGATTATGTGCTCTCGAGAGCACATAATCCTTCATCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000136932    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016030.5-300s1c1
Sequence:CCGGCAGGAGGAAACCATCGATCTTCTCGAGAAGATCGATGGTTTCCTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000137445    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016030.5-897s1c1
Sequence:CCGGGCCTTCATTTCCGTCAGCAATCTCGAGATTGCTGACGGAAATGAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000454928    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016030.5-1305s21c1
Sequence:CCGGGCAAAGAGACAAGTCCTAAATCTCGAGATTTAGGACTTGTCTCTTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427957    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016030.5-2090s21c1
Sequence:CCGGCCTTCACCTCGGGCAGAATAACTCGAGTTATTCTGCCCGAGGTGAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426819    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016030.5-1565s21c1
Sequence:CCGGTCTTGATCAGCCAGATCTTTACTCGAGTAAAGATCTGGCTGATCAAGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417608    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016030.5-1909s21c1
Sequence:CCGGATCATTCGGTTATCAAGTATTCTCGAGAATACTTGATAACCGAATGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks