EMAIL THIS PAGE TO A FRIEND

TRAPPC13

trafficking protein particle complex 13

Synonyms: C5orf44
Gene ID:
Mouse(66975) trafficking protein particle complex 13
Rat(294709) trafficking protein particle complex 13
Zebrafish(321203) trafficking protein particle complex 13
dog(478079) trafficking protein particle complex 13
cow(511108) trafficking protein particle complex 13
domestic guinea pig(100729683) trafficking protein particle complex 13
naked mole-rat(101713424) trafficking protein particle complex 13
130 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024941 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024941 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024941 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025879 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025879 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025879 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU154301 MISSION® esiRNA esiRNA targeting mouse 2410002O22Rik mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001093755 Rosetta Predictions human pricing
NM_001093756 Rosetta Predictions human pricing
NM_024941 Rosetta Predictions human pricing
NR_003545 Rosetta Predictions human pricing
NM_001013908 Rosetta Predictions rat pricing
NM_001093759 Rosetta Predictions mouse pricing
NM_001093760 Rosetta Predictions mouse pricing
NM_025879 Rosetta Predictions mouse pricing
NR_003546 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093755 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318151 predicted 442
2 SASI_Hs02_00318152 predicted 570
3 SASI_Hs02_00318153 predicted 375
4 SASI_Hs02_00318154 predicted 483
5 SASI_Hs02_00318155 predicted 1668
6 SASI_Hs02_00318156 predicted 470
7 SASI_Hs02_00318157 predicted 640
8 SASI_Hs02_00318158 predicted 1659
9 SASI_Hs02_00318159 predicted 1558
10 SASI_Hs02_00318160 predicted 637
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093756 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00318161 predicted 441
2 SASI_Hs02_00318162 predicted 565
3 SASI_Hs02_00318163 predicted 380
4 SASI_Hs02_00318164 predicted 476
5 SASI_Hs02_00318165 predicted 1647
6 SASI_Hs02_00318166 predicted 463
7 SASI_Hs02_00318167 predicted 636
8 SASI_Hs02_00318168 predicted 1644
9 SASI_Hs02_00318169 predicted 1545
10 SASI_Hs02_00318170 predicted 636
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024941 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00357579 predicted 442
2 SASI_Hs01_00203214 predicted 568
3 SASI_Hs02_00357580 predicted 381
4 SASI_Hs02_00357581 predicted 483
5 SASI_Hs01_00203216 predicted 1658
6 SASI_Hs02_00357582 predicted 471
7 SASI_Hs01_00203219 predicted 637
8 SASI_Hs02_00357583 predicted 1659
9 SASI_Hs02_00357584 predicted 1555
10 SASI_Hs02_00357585 predicted 635
11 SASI_Hs01_00203215 predicted 656
12 SASI_Hs01_00203217 predicted 445
13 SASI_Hs01_00203218 predicted 817
14 SASI_Hs01_00203220 predicted 1101
15 SASI_Hs01_00203221 predicted 720
16 SASI_Hs01_00203222 predicted 905
17 SASI_Hs01_00203223 predicted 1176
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003545 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00379495 predicted 762
2 SASI_Hs02_00379496 predicted 487
3 SASI_Hs02_00379497 predicted 868
4 SASI_Hs02_00379498 predicted 955
5 SASI_Hs02_00379499 predicted 498
6 SASI_Hs02_00379500 predicted 746
7 SASI_Hs02_00379501 predicted 997
8 SASI_Hs02_00379502 predicted 1238
9 SASI_Hs02_00379503 predicted 734
10 SASI_Hs02_00379504 predicted 594
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001013908 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00059579 predicted 961
2 SASI_Rn01_00059580 predicted 482
3 SASI_Rn01_00059581 predicted 1011
4 SASI_Rn02_00201193 predicted 853
5 SASI_Rn02_00201194 predicted 747
6 SASI_Rn01_00059583 predicted 736
7 SASI_Rn01_00059584 predicted 1134
8 SASI_Rn02_00201195 predicted 749
9 SASI_Rn01_00059586 predicted 989
10 SASI_Rn01_00059587 predicted 1188
11 SASI_Rn01_00059582 predicted 816
12 SASI_Rn01_00059585 predicted 586
13 SASI_Rn01_00059588 predicted 608
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093759 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301089 predicted 620
2 SASI_Mm02_00301090 predicted 1073
3 SASI_Mm02_00301091 predicted 447
4 SASI_Mm02_00301092 predicted 362
5 SASI_Mm02_00301093 predicted 2016
6 SASI_Mm02_00301094 predicted 408
7 SASI_Mm02_00301095 predicted 2011
8 SASI_Mm02_00301096 predicted 2059
9 SASI_Mm02_00301097 predicted 383
10 SASI_Mm02_00301098 predicted 611
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001093760 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301099 predicted 615
2 SASI_Mm02_00301100 predicted 1058
3 SASI_Mm02_00301101 predicted 446
4 SASI_Mm02_00301102 predicted 363
5 SASI_Mm02_00301103 predicted 1997
6 SASI_Mm02_00301104 predicted 406
7 SASI_Mm02_00301105 predicted 1998
8 SASI_Mm02_00301106 predicted 2041
9 SASI_Mm02_00301107 predicted 380
10 SASI_Mm02_00301108 predicted 615
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025879 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00329206 predicted 618
2 SASI_Mm01_00144426 predicted 1074
3 SASI_Mm02_00329207 predicted 441
4 SASI_Mm02_00329208 predicted 371
5 SASI_Mm02_00329209 predicted 2017
6 SASI_Mm02_00329210 predicted 408
7 SASI_Mm02_00329211 predicted 2014
8 SASI_Mm02_00329212 predicted 2058
9 SASI_Mm02_00329213 predicted 383
10 SASI_Mm02_00329214 predicted 616
11 SASI_Mm01_00144424 predicted 1414
12 SASI_Mm01_00144425 predicted 1158
13 SASI_Mm01_00144427 predicted 856
14 SASI_Mm01_00144428 predicted 1062
15 SASI_Mm01_00144429 predicted 1075
16 SASI_Mm01_00144430 predicted 769
17 SASI_Mm01_00144431 predicted 651
18 SASI_Mm01_00144432 predicted 1449
19 SASI_Mm01_00144433 predicted 638
siRNA
PRODUCT # siRNA Type ? SPECIES
NR_003546 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00353450 predicted 459
2 SASI_Mm02_00353451 predicted 628
3 SASI_Mm02_00353452 predicted 734
4 SASI_Mm02_00353453 predicted 928
5 SASI_Mm02_00353454 predicted 961
6 SASI_Mm02_00353455 predicted 713
7 SASI_Mm02_00353456 predicted 412
8 SASI_Mm02_00353457 predicted 1046
9 SASI_Mm02_00353458 predicted 1351
10 SASI_Mm02_00353459 predicted 416
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024941
VALIDATED
TRAPPC13 MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 13
Human
19 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000435300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024941.3-1913s21c1
Sequence:CCGGTGTAAGGTACAAGATACTAAACTCGAGTTTAGTATCTTGTACCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000434647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024941.3-472s21c1
Sequence:CCGGGATGATCCTTCAACCGTTAATCTCGAGATTAACGGTTGAAGGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024941.3-642s21c1
Sequence:CCGGGACAAGTTCTCAGCGTTTAAACTCGAGTTTAAACGCTGAGAACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000431576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024941.3-574s21c1
Sequence:CCGGAGTTATATCAGCGTTCATAATCTCGAGATTATGAACGCTGATATAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024941.3-1656s21c1
Sequence:CCGGTGACGTCAACAACGAAGTAAACTCGAGTTTACTTCGTTGTTGACGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024941.3-1038s21c1
Sequence:CCGGGTTTGGGTCAAGAGCATATTTCTCGAGAAATATGCTCTTGACCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024941.1-614s1c1
Sequence:CCGGGAATATGACAACCTCACCTATCTCGAGATAGGTGAGGTTGTCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024941.1-1212s1c1
Sequence:CCGGGAATATGATGACATCGCACAACTCGAGTTGTGCGATGTCATCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024941.1-376s1c1
Sequence:CCGGCTGAACTTAAACCGGATTGTTCTCGAGAACAATCCGGTTTAAGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024941.1-387s1c1
Sequence:CCGGCCGGATTGTTGTATTGATGATCTCGAGATCATCAATACAACAATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000139341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024941.1-1107s1c1
Sequence:CCGGCCAAGTTCTTCGCTCTGTCTTCTCGAGAAGACAGAGCGAAGAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000140083    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024941.1-1638s1c1
Sequence:CCGGGCCGTAAGGTTTCTGTCACAACTCGAGTTGTGACAGAAACCTTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024941.1-648s1c1
Sequence:CCGGGTTTCACTGGAGCCATCTATTCTCGAGAATAGATGGCTCCAGTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024941.1-1513s1c1
Sequence:CCGGCCATTGGACTTTGTTCTCCAACTCGAGTTGGAGAACAAAGTCCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024941.1-1017s1c1
Sequence:CCGGGAAAGGACTATGGATCTGGTTCTCGAGAACCAGATCCATAGTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024941.1-957s1c1
Sequence:CCGGCCAGATACCGTAAACCTTGAACTCGAGTTCAAGGTTTACGGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024941.1-763s1c1
Sequence:CCGGGCCAGTACTTATACTGCCTAACTCGAGTTAGGCAGTATAAGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024941.1-2377s1c1
Sequence:CCGGCCATGTAATCACACTTAGTTACTCGAGTAACTAAGTGTGATTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121766    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_024941.1-1639s1c1
Sequence:CCGGCCGTAAGGTTTCTGTCACAAACTCGAGTTTGTGACAGAAACCTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024941
VALIDATED
TRAPPC13 MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 13
Human
19 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000435300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024941.3-1913s21c1
Sequence:CCGGTGTAAGGTACAAGATACTAAACTCGAGTTTAGTATCTTGTACCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000434647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024941.3-472s21c1
Sequence:CCGGGATGATCCTTCAACCGTTAATCTCGAGATTAACGGTTGAAGGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024941.3-642s21c1
Sequence:CCGGGACAAGTTCTCAGCGTTTAAACTCGAGTTTAAACGCTGAGAACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000431576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024941.3-574s21c1
Sequence:CCGGAGTTATATCAGCGTTCATAATCTCGAGATTATGAACGCTGATATAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024941.3-1656s21c1
Sequence:CCGGTGACGTCAACAACGAAGTAAACTCGAGTTTACTTCGTTGTTGACGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024941.3-1038s21c1
Sequence:CCGGGTTTGGGTCAAGAGCATATTTCTCGAGAAATATGCTCTTGACCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024941.1-614s1c1
Sequence:CCGGGAATATGACAACCTCACCTATCTCGAGATAGGTGAGGTTGTCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024941.1-1212s1c1
Sequence:CCGGGAATATGATGACATCGCACAACTCGAGTTGTGCGATGTCATCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024941.1-376s1c1
Sequence:CCGGCTGAACTTAAACCGGATTGTTCTCGAGAACAATCCGGTTTAAGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024941.1-387s1c1
Sequence:CCGGCCGGATTGTTGTATTGATGATCTCGAGATCATCAATACAACAATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000139341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024941.1-1107s1c1
Sequence:CCGGCCAAGTTCTTCGCTCTGTCTTCTCGAGAAGACAGAGCGAAGAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000140083    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024941.1-1638s1c1
Sequence:CCGGGCCGTAAGGTTTCTGTCACAACTCGAGTTGTGACAGAAACCTTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024941.1-648s1c1
Sequence:CCGGGTTTCACTGGAGCCATCTATTCTCGAGAATAGATGGCTCCAGTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024941.1-1513s1c1
Sequence:CCGGCCATTGGACTTTGTTCTCCAACTCGAGTTGGAGAACAAAGTCCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024941.1-1017s1c1
Sequence:CCGGGAAAGGACTATGGATCTGGTTCTCGAGAACCAGATCCATAGTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024941.1-957s1c1
Sequence:CCGGCCAGATACCGTAAACCTTGAACTCGAGTTCAAGGTTTACGGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024941.1-763s1c1
Sequence:CCGGGCCAGTACTTATACTGCCTAACTCGAGTTAGGCAGTATAAGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024941.1-2377s1c1
Sequence:CCGGCCATGTAATCACACTTAGTTACTCGAGTAACTAAGTGTGATTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121766    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_024941.1-1639s1c1
Sequence:CCGGCCGTAAGGTTTCTGTCACAAACTCGAGTTTGTGACAGAAACCTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024941
VALIDATED
TRAPPC13 MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 13
Human
19 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000435300    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024941.3-1913s21c1
Sequence:CCGGTGTAAGGTACAAGATACTAAACTCGAGTTTAGTATCTTGTACCTTACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000434647    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024941.3-472s21c1
Sequence:CCGGGATGATCCTTCAACCGTTAATCTCGAGATTAACGGTTGAAGGATCATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414357    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024941.3-642s21c1
Sequence:CCGGGACAAGTTCTCAGCGTTTAAACTCGAGTTTAAACGCTGAGAACTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000431576    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024941.3-574s21c1
Sequence:CCGGAGTTATATCAGCGTTCATAATCTCGAGATTATGAACGCTGATATAACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433535    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024941.3-1656s21c1
Sequence:CCGGTGACGTCAACAACGAAGTAAACTCGAGTTTACTTCGTTGTTGACGTCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427067    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024941.3-1038s21c1
Sequence:CCGGGTTTGGGTCAAGAGCATATTTCTCGAGAAATATGCTCTTGACCCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144986    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024941.1-614s1c1
Sequence:CCGGGAATATGACAACCTCACCTATCTCGAGATAGGTGAGGTTGTCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144715    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024941.1-1212s1c1
Sequence:CCGGGAATATGATGACATCGCACAACTCGAGTTGTGCGATGTCATCATATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144160    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024941.1-376s1c1
Sequence:CCGGCTGAACTTAAACCGGATTGTTCTCGAGAACAATCCGGTTTAAGTTCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143969    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_024941.1-387s1c1
Sequence:CCGGCCGGATTGTTGTATTGATGATCTCGAGATCATCAATACAACAATCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000139341    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024941.1-1107s1c1
Sequence:CCGGCCAAGTTCTTCGCTCTGTCTTCTCGAGAAGACAGAGCGAAGAACTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000140083    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024941.1-1638s1c1
Sequence:CCGGGCCGTAAGGTTTCTGTCACAACTCGAGTTGTGACAGAAACCTTACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143221    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024941.1-648s1c1
Sequence:CCGGGTTTCACTGGAGCCATCTATTCTCGAGAATAGATGGCTCCAGTGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143848    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024941.1-1513s1c1
Sequence:CCGGCCATTGGACTTTGTTCTCCAACTCGAGTTGGAGAACAAAGTCCAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143555    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024941.1-1017s1c1
Sequence:CCGGGAAAGGACTATGGATCTGGTTCTCGAGAACCAGATCCATAGTCCTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143849    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.9 Cell Line: A549
TRC Version: 1.5 Clone ID:NM_024941.1-957s1c1
Sequence:CCGGCCAGATACCGTAAACCTTGAACTCGAGTTCAAGGTTTACGGTATCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122179    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024941.1-763s1c1
Sequence:CCGGGCCAGTACTTATACTGCCTAACTCGAGTTAGGCAGTATAAGTACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121590    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_024941.1-2377s1c1
Sequence:CCGGCCATGTAATCACACTTAGTTACTCGAGTAACTAAGTGTGATTACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121766    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.66 Cell Line: A549
TRC Version: 1 Clone ID:NM_024941.1-1639s1c1
Sequence:CCGGCCGTAAGGTTTCTGTCACAAACTCGAGTTTGTGACAGAAACCTTACGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025879
VALIDATED
TRAPPC13 MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 13
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025879.2-2040s21c1
Sequence:CCGGTCGAATTTCCATGATACTTAACTCGAGTTAAGTATCATGGAAATTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025879.2-619s21c1
Sequence:CCGGGACGAGTTCTCAGCGTTTAAACTCGAGTTTAAACGCTGAGAACTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025879.2-1125s21c1
Sequence:CCGGTAATTGGGAAACTGGATATAGCTCGAGCTATATCCAGTTTCCCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025879.2-372s21c1
Sequence:CCGGCTACTTTGTTCACCAATATTCCTCGAGGAATATTGGTGAACAAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000285811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025879.2-1023s21c1
Sequence:CCGGCCAGAGGATATTTGCAGCCAACTCGAGTTGGCTGCAAATATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025879.1-981s1c1
Sequence:CCGGCCAGAGGATATTTGCAGCCAACTCGAGTTGGCTGCAAATATCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025879.1-1011s1c1
Sequence:CCGGGCCAATACTTATACTGCCTAACTCGAGTTAGGCAGTATAAGTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025879.1-1969s1c1
Sequence:CCGGGCTGGAAGACACCATTTGCTTCTCGAGAAGCAAATGGTGTCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025879.1-1745s1c1
Sequence:CCGGCCTTTAAGATACCTGTCATTTCTCGAGAAATGACAGGTATCTTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025879
VALIDATED
TRAPPC13 MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 13
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025879.2-2040s21c1
Sequence:CCGGTCGAATTTCCATGATACTTAACTCGAGTTAAGTATCATGGAAATTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025879.2-619s21c1
Sequence:CCGGGACGAGTTCTCAGCGTTTAAACTCGAGTTTAAACGCTGAGAACTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025879.2-1125s21c1
Sequence:CCGGTAATTGGGAAACTGGATATAGCTCGAGCTATATCCAGTTTCCCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025879.2-372s21c1
Sequence:CCGGCTACTTTGTTCACCAATATTCCTCGAGGAATATTGGTGAACAAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000285811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025879.2-1023s21c1
Sequence:CCGGCCAGAGGATATTTGCAGCCAACTCGAGTTGGCTGCAAATATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025879.1-981s1c1
Sequence:CCGGCCAGAGGATATTTGCAGCCAACTCGAGTTGGCTGCAAATATCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025879.1-1011s1c1
Sequence:CCGGGCCAATACTTATACTGCCTAACTCGAGTTAGGCAGTATAAGTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025879.1-1969s1c1
Sequence:CCGGGCTGGAAGACACCATTTGCTTCTCGAGAAGCAAATGGTGTCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025879.1-1745s1c1
Sequence:CCGGCCTTTAAGATACCTGTCATTTCTCGAGAAATGACAGGTATCTTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025879
VALIDATED
TRAPPC13 MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 13
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276991    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025879.2-2040s21c1
Sequence:CCGGTCGAATTTCCATGATACTTAACTCGAGTTAAGTATCATGGAAATTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276993    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025879.2-619s21c1
Sequence:CCGGGACGAGTTCTCAGCGTTTAAACTCGAGTTTAAACGCTGAGAACTCGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025879.2-1125s21c1
Sequence:CCGGTAATTGGGAAACTGGATATAGCTCGAGCTATATCCAGTTTCCCAATTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025879.2-372s21c1
Sequence:CCGGCTACTTTGTTCACCAATATTCCTCGAGGAATATTGGTGAACAAAGTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000285811    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_025879.2-1023s21c1
Sequence:CCGGCCAGAGGATATTTGCAGCCAACTCGAGTTGGCTGCAAATATCCTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202198    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025879.1-981s1c1
Sequence:CCGGCCAGAGGATATTTGCAGCCAACTCGAGTTGGCTGCAAATATCCTCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191483    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025879.1-1011s1c1
Sequence:CCGGGCCAATACTTATACTGCCTAACTCGAGTTAGGCAGTATAAGTATTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190018    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025879.1-1969s1c1
Sequence:CCGGGCTGGAAGACACCATTTGCTTCTCGAGAAGCAAATGGTGTCTTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191305    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.63 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_025879.1-1745s1c1
Sequence:CCGGCCTTTAAGATACCTGTCATTTCTCGAGAAATGACAGGTATCTTAAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks