EMAIL THIS PAGE TO A FRIEND

TRAPPC1

trafficking protein particle complex 1

Synonyms: BET5 MUM2
UniProtKB ID: Q9Y5R8, D3DTR0
Gene ID:
Human(58485) Summary: This gene product plays a role in vesicular transport of proteins to the Golgi apparatus from the endoplasmic reticulum. The encoded protein is a component of the multisubunit transport protein particle (TRAPP) complex. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Oct 2009]
Mouse(245828) trafficking protein particle complex 1
Rat(287427) trafficking protein particle complex 1
cow(616205) trafficking protein particle complex 1
sheep(101105262) trafficking protein particle complex 1
domestic guinea pig(100733023) trafficking protein particle complex 1
naked mole-rat(101708354) trafficking protein particle complex 1
Zebrafish(437015) trafficking protein particle complex 1
dog(479490) trafficking protein particle complex 1
domestic cat(101101008) trafficking protein particle complex 1
55 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_021210 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021210 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021210 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001024206 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001024206 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001024206 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021210 Rosetta Predictions human pricing
NM_001039378 Rosetta Predictions rat pricing
NM_001024206 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021210 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013615 predicted 310
2 SASI_Hs01_00013616 predicted 332
3 SASI_Hs02_00354800 predicted 340
4 SASI_Hs01_00013617 predicted 312
5 SASI_Hs02_00354801 predicted 246
6 SASI_Hs01_00013619 predicted 374
7 SASI_Hs01_00013620 predicted 312
8 SASI_Hs01_00013621 predicted 243
9 SASI_Hs01_00013622 predicted 229
10 SASI_Hs02_00354802 predicted 245
11 SASI_Hs01_00013614 predicted 355
12 SASI_Hs01_00013618 predicted 319
13 SASI_Hs01_00013623 predicted 217
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001039378 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00087632 predicted 264
2 SASI_Rn01_00087633 predicted 237
3 SASI_Rn02_00204836 predicted 269
4 SASI_Rn01_00087635 predicted 304
5 SASI_Rn01_00087636 predicted 227
6 SASI_Rn01_00087638 predicted 306
7 SASI_Rn01_00087639 predicted 296
8 SASI_Rn01_00087640 predicted 231
9 SASI_Rn01_00087641 predicted 262
10 SASI_Rn02_00204837 predicted 307
11 SASI_Rn01_00087634 predicted 307
12 SASI_Rn01_00087637 predicted 258
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024206 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162065 predicted 475
2 SASI_Mm01_00162066 predicted 352
3 SASI_Mm02_00287571 predicted 388
4 SASI_Mm01_00162067 predicted 465
5 SASI_Mm01_00162068 predicted 312
6 SASI_Mm01_00162069 predicted 274
7 SASI_Mm02_00287572 predicted 433
8 SASI_Mm01_00162070 predicted 352
9 SASI_Mm01_00162072 predicted 271
10 SASI_Mm02_00287573 predicted 416
11 SASI_Mm01_00162071 predicted 392
12 SASI_Mm01_00162073 predicted 436
13 SASI_Mm01_00162074 predicted 294
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021210
VALIDATED
TRAPPC1 MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021210.4-472s21c1
Sequence:CCGGGGCCAAACTGTGCAAAGTGAGCTCGAGCTCACTTTGCACAGTTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021210.4-357s21c1
Sequence:CCGGGATCAAAGTTGTCATGAATACCTCGAGGTATTCATGACAACTTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021210.2-323s1c1
Sequence:CCGGCCGTTACAAACTCCATTACTACTCGAGTAGTAATGGAGTTTGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021210.2-189s1c1
Sequence:CCGGCGCAAGAAGCAAGCAGGGATTCTCGAGAATCCCTGCTTGCTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021210.2-417s1c1
Sequence:CCGGCACATCTACAGTGCGCTGTATCTCGAGATACAGCGCACTGTAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021210.2-155s1c1
Sequence:CCGGGAATGGAGTGTGTCTGCACTACTCGAGTAGTGCAGACACACTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021210.2-311s1c1
Sequence:CCGGCTTCCAAACTAGCCGTTACAACTCGAGTTGTAACGGCTAGTTTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021210
VALIDATED
TRAPPC1 MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021210.4-472s21c1
Sequence:CCGGGGCCAAACTGTGCAAAGTGAGCTCGAGCTCACTTTGCACAGTTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021210.4-357s21c1
Sequence:CCGGGATCAAAGTTGTCATGAATACCTCGAGGTATTCATGACAACTTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021210.2-323s1c1
Sequence:CCGGCCGTTACAAACTCCATTACTACTCGAGTAGTAATGGAGTTTGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021210.2-189s1c1
Sequence:CCGGCGCAAGAAGCAAGCAGGGATTCTCGAGAATCCCTGCTTGCTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021210.2-417s1c1
Sequence:CCGGCACATCTACAGTGCGCTGTATCTCGAGATACAGCGCACTGTAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021210.2-155s1c1
Sequence:CCGGGAATGGAGTGTGTCTGCACTACTCGAGTAGTGCAGACACACTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021210.2-311s1c1
Sequence:CCGGCTTCCAAACTAGCCGTTACAACTCGAGTTGTAACGGCTAGTTTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021210
VALIDATED
TRAPPC1 MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021210.4-472s21c1
Sequence:CCGGGGCCAAACTGTGCAAAGTGAGCTCGAGCTCACTTTGCACAGTTTGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021210.4-357s21c1
Sequence:CCGGGATCAAAGTTGTCATGAATACCTCGAGGTATTCATGACAACTTTGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059508    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021210.2-323s1c1
Sequence:CCGGCCGTTACAAACTCCATTACTACTCGAGTAGTAATGGAGTTTGTAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059509    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021210.2-189s1c1
Sequence:CCGGCGCAAGAAGCAAGCAGGGATTCTCGAGAATCCCTGCTTGCTTCTTGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059511    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: MCH58
TRC Version: 1 Clone ID:NM_021210.2-417s1c1
Sequence:CCGGCACATCTACAGTGCGCTGTATCTCGAGATACAGCGCACTGTAGATGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059512    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021210.2-155s1c1
Sequence:CCGGGAATGGAGTGTGTCTGCACTACTCGAGTAGTGCAGACACACTCCATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059510    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021210.2-311s1c1
Sequence:CCGGCTTCCAAACTAGCCGTTACAACTCGAGTTGTAACGGCTAGTTTGGAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001024206
VALIDATED
TRAPPC1 MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 1
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000252586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024206.2-472s21c1
Sequence:CCGGGACTCCTATGTCCGATCTTTGCTCGAGCAAAGATCGGACATAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024206.2-562s21c1
Sequence:CCGGCCCATCTCACTTGTTACATTGCTCGAGCAATGTAACAAGTGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024206.2-179s21c1
Sequence:CCGGAGGAGTACAAGCTGATGTATGCTCGAGCATACATCAGCTTGTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000252583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024206.2-280s21c1
Sequence:CCGGAGCCGTTACAAACTCCATTACCTCGAGGTAATGGAGTTTGTAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000267434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024206.2-360s21c1
Sequence:CCGGCCGAGATGTTCTACACCATATCTCGAGATATGGTGTAGAACATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024206.1-195s1c1
Sequence:CCGGGCTGATGTATGGAATGCTCTTCTCGAGAAGAGCATTCCATACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201282    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024206.1-567s1c1
Sequence:CCGGGCCCATCTCACTTGTTACATTCTCGAGAATGTAACAAGTGAGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024206.1-273s1c1
Sequence:CCGGGTCTTTCCAAACTAGCCGTTACTCGAGTAACGGCTAGTTTGGAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001024206
VALIDATED
TRAPPC1 MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 1
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000252586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024206.2-472s21c1
Sequence:CCGGGACTCCTATGTCCGATCTTTGCTCGAGCAAAGATCGGACATAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024206.2-562s21c1
Sequence:CCGGCCCATCTCACTTGTTACATTGCTCGAGCAATGTAACAAGTGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024206.2-179s21c1
Sequence:CCGGAGGAGTACAAGCTGATGTATGCTCGAGCATACATCAGCTTGTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000252583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024206.2-280s21c1
Sequence:CCGGAGCCGTTACAAACTCCATTACCTCGAGGTAATGGAGTTTGTAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000267434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024206.2-360s21c1
Sequence:CCGGCCGAGATGTTCTACACCATATCTCGAGATATGGTGTAGAACATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024206.1-195s1c1
Sequence:CCGGGCTGATGTATGGAATGCTCTTCTCGAGAAGAGCATTCCATACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201282    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024206.1-567s1c1
Sequence:CCGGGCCCATCTCACTTGTTACATTCTCGAGAATGTAACAAGTGAGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024206.1-273s1c1
Sequence:CCGGGTCTTTCCAAACTAGCCGTTACTCGAGTAACGGCTAGTTTGGAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001024206
VALIDATED
TRAPPC1 MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 1
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000252586    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024206.2-472s21c1
Sequence:CCGGGACTCCTATGTCCGATCTTTGCTCGAGCAAAGATCGGACATAGGAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252585    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024206.2-562s21c1
Sequence:CCGGCCCATCTCACTTGTTACATTGCTCGAGCAATGTAACAAGTGAGATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252584    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001024206.2-179s21c1
Sequence:CCGGAGGAGTACAAGCTGATGTATGCTCGAGCATACATCAGCTTGTACTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000252583    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024206.2-280s21c1
Sequence:CCGGAGCCGTTACAAACTCCATTACCTCGAGGTAATGGAGTTTGTAACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000267434    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_001024206.2-360s21c1
Sequence:CCGGCCGAGATGTTCTACACCATATCTCGAGATATGGTGTAGAACATCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201323    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024206.1-195s1c1
Sequence:CCGGGCTGATGTATGGAATGCTCTTCTCGAGAAGAGCATTCCATACATCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201282    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_001024206.1-567s1c1
Sequence:CCGGGCCCATCTCACTTGTTACATTCTCGAGAATGTAACAAGTGAGATGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192960    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_001024206.1-273s1c1
Sequence:CCGGGTCTTTCCAAACTAGCCGTTACTCGAGTAACGGCTAGTTTGGAAAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks