EMAIL THIS PAGE TO A FRIEND

TRAPPC2

trafficking protein particle complex 2

Synonyms: MIP2A SEDL SEDT TRAPPC2P1 TRS20 ZNF547L hYP38334
UniProtKB ID: P0DI81, A6NEG0, O14582, Q9HD16
Gene ID:
Human(6399) Summary: The protein encoded by this gene is thought to be part of a large multi-subunit complex involved in the targeting and fusion of endoplasmic reticulum-to-Golgi transport vesicles with their acceptor compartment. In addition, the encoded protein can bind c-myc promoter-binding protein 1 and block its transcriptional repression capability. Mutations in this gene are a cause of spondyloepiphyseal dysplasia tarda (SEDT). A processed pseudogene of this gene is located on chromosome 19, and other pseudogenes are found on chromosomes 8 and Y. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2010]
Mouse(66226) trafficking protein particle complex 2
Rat(501550) trafficking protein particle complex 2
naked mole-rat(101721959) trafficking protein particle complex 2
domestic guinea pig(100735333) trafficking protein particle complex 2
cow(616748) trafficking protein particle complex 2
Zebrafish(767808) trafficking protein particle complex 2
domestic cat(101089495) trafficking protein particle complex 2
chicken(418634) trafficking protein particle complex 2
dog(480840) trafficking protein particle complex 2
67 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025432 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025432 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025432 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014563 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014563 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014563 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EMU147241 MISSION® esiRNA esiRNA targeting mouse Trappc2 mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001011658 Rosetta Predictions human pricing
NM_014563 Rosetta Predictions human pricing
NM_001024965 Rosetta Predictions rat pricing
NM_025432 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001011658 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00215347 predicted 689
2 SASI_Hs01_00215348 predicted 435
3 SASI_Hs01_00215349 predicted 447
4 SASI_Hs01_00215350 predicted 594
5 SASI_Hs01_00215351 predicted 542
6 SASI_Hs01_00215352 predicted 517
7 SASI_Hs01_00215353 predicted 588
8 SASI_Hs01_00215354 predicted 699
9 SASI_Hs01_00215356 predicted 762
10 SASI_Hs02_00306007 predicted 330
11 SASI_Hs01_00215355 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014563 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00113925 predicted 540
2 SASI_Hs01_00113926 predicted 296
3 SASI_Hs01_00113927 predicted 306
4 SASI_Hs01_00113928 predicted 453
5 SASI_Hs01_00113929 predicted 403
6 SASI_Hs01_00113930 predicted 376
7 SASI_Hs01_00113931 predicted 443
8 SASI_Hs01_00113932 predicted 562
9 SASI_Hs01_00113934 predicted 619
10 SASI_Hs02_00345826 predicted 189
11 SASI_Hs01_00113933 predicted 565
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024965 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00066177 predicted 333
2 SASI_Rn01_00066178 predicted 400
3 SASI_Rn01_00066179 predicted 380
4 SASI_Rn01_00066180 predicted 793
5 SASI_Rn01_00066181 predicted 690
6 SASI_Rn01_00066182 predicted 458
7 SASI_Rn02_00202814 predicted 386
8 SASI_Rn01_00066183 predicted 755
9 SASI_Rn01_00066185 predicted 340
10 SASI_Rn02_00202815 predicted 464
11 SASI_Rn01_00066184 predicted 303
12 SASI_Rn01_00066186 predicted 426
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025432 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00055981 predicted 337
2 SASI_Mm02_00328239 predicted 492
3 SASI_Mm02_00328240 predicted 471
4 SASI_Mm01_00055985 predicted 454
5 SASI_Mm02_00328241 predicted 405
6 SASI_Mm02_00328242 predicted 495
7 SASI_Mm02_00328243 predicted 285
8 SASI_Mm02_00328244 predicted 229
9 SASI_Mm02_00328245 predicted 515
10 SASI_Mm02_00328246 predicted 255
11 SASI_Mm01_00055976 predicted 630
12 SASI_Mm01_00055977 predicted 290
13 SASI_Mm01_00055978 predicted 739
14 SASI_Mm01_00055979 predicted 609
15 SASI_Mm01_00055980 predicted 658
16 SASI_Mm01_00055982 predicted 703
17 SASI_Mm01_00055983 predicted 702
18 SASI_Mm01_00055984 predicted 343
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025432
VALIDATED
TRAPPC2 MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000108610    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025432.1-702s1c1
Sequence:CCGGGCCGAAGATAATATGATCTTACTCGAGTAAGATCATATTATCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025432.1-264s1c1
Sequence:CCGGGAGTGGTTTGTATCAGCCTTTCTCGAGAAAGGCTGATACAAACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025432.1-438s1c1
Sequence:CCGGGACAGGAAAGTCCAGTTTCTTCTCGAGAAGAAACTGGACTTTCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025432.1-291s1c1
Sequence:CCGGGCAGGGCATATGAGATTTATTCTCGAGAATAAATCTCATATGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000108612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025432.1-336s1c1
Sequence:CCGGGATGGGATAAAGAACCTCTTTCTCGAGAAAGAGGTTCTTTATCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025432
VALIDATED
TRAPPC2 MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000108610    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025432.1-702s1c1
Sequence:CCGGGCCGAAGATAATATGATCTTACTCGAGTAAGATCATATTATCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025432.1-264s1c1
Sequence:CCGGGAGTGGTTTGTATCAGCCTTTCTCGAGAAAGGCTGATACAAACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025432.1-438s1c1
Sequence:CCGGGACAGGAAAGTCCAGTTTCTTCTCGAGAAGAAACTGGACTTTCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025432.1-291s1c1
Sequence:CCGGGCAGGGCATATGAGATTTATTCTCGAGAATAAATCTCATATGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000108612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025432.1-336s1c1
Sequence:CCGGGATGGGATAAAGAACCTCTTTCTCGAGAAAGAGGTTCTTTATCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025432
VALIDATED
TRAPPC2 MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000108610    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.77 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025432.1-702s1c1
Sequence:CCGGGCCGAAGATAATATGATCTTACTCGAGTAAGATCATATTATCTTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108611    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025432.1-264s1c1
Sequence:CCGGGAGTGGTTTGTATCAGCCTTTCTCGAGAAAGGCTGATACAAACCACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108614    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025432.1-438s1c1
Sequence:CCGGGACAGGAAAGTCCAGTTTCTTCTCGAGAAGAAACTGGACTTTCCTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025432.1-291s1c1
Sequence:CCGGGCAGGGCATATGAGATTTATTCTCGAGAATAAATCTCATATGCCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000108612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: B16-F0
TRC Version: 1 Clone ID:NM_025432.1-336s1c1
Sequence:CCGGGATGGGATAAAGAACCTCTTTCTCGAGAAAGAGGTTCTTTATCCCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014563
VALIDATED
TRAPPC2 MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 2
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000018935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_014563.2-135s1c1
Sequence:CCGGGCCACCATGATAATCCAGTTTCTCGAGAAACTGGATTATCATGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014563.2-185s1c1
Sequence:CCGGGCAGAATCCAAAGACGACCATCTCGAGATGGTCGTCTTTGGATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014563.2-453s1c1
Sequence:CCGGCCAATTCTCCTATTCGATCAACTCGAGTTGATCGAATAGGAGAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014563.2-308s1c1
Sequence:CCGGGAGTGGTTTGTGTCGGCATTTCTCGAGAAATGCCGACACAAACCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000018937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014563.2-206s1c1
Sequence:CCGGCGTCATCTGAACCAGTTCATACTCGAGTATGAACTGGTTCAGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014563.5-653s21c1
Sequence:CCGGTGTATTCTCAGCTTATCTAAACTCGAGTTTAGATAAGCTGAGAATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014563.5-292s21c1
Sequence:CCGGGCTATCGAACAACATGTACTTCTCGAGAAGTACATGTTGTTCGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000418169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014563.5-750s21c1
Sequence:CCGGCCTTGTGAACAGTGTTATTTACTCGAGTAAATAACACTGTTCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014563.5-710s21c1
Sequence:CCGGTTCTGTCTCATGTCACGTATCCTCGAGGATACGTGACATGAGACAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014563
VALIDATED
TRAPPC2 MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 2
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000018935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_014563.2-135s1c1
Sequence:CCGGGCCACCATGATAATCCAGTTTCTCGAGAAACTGGATTATCATGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014563.2-185s1c1
Sequence:CCGGGCAGAATCCAAAGACGACCATCTCGAGATGGTCGTCTTTGGATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014563.2-453s1c1
Sequence:CCGGCCAATTCTCCTATTCGATCAACTCGAGTTGATCGAATAGGAGAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014563.2-308s1c1
Sequence:CCGGGAGTGGTTTGTGTCGGCATTTCTCGAGAAATGCCGACACAAACCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000018937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014563.2-206s1c1
Sequence:CCGGCGTCATCTGAACCAGTTCATACTCGAGTATGAACTGGTTCAGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014563.5-653s21c1
Sequence:CCGGTGTATTCTCAGCTTATCTAAACTCGAGTTTAGATAAGCTGAGAATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014563.5-292s21c1
Sequence:CCGGGCTATCGAACAACATGTACTTCTCGAGAAGTACATGTTGTTCGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000418169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014563.5-750s21c1
Sequence:CCGGCCTTGTGAACAGTGTTATTTACTCGAGTAAATAACACTGTTCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014563.5-710s21c1
Sequence:CCGGTTCTGTCTCATGTCACGTATCCTCGAGGATACGTGACATGAGACAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014563
VALIDATED
TRAPPC2 MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 2
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000018935    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A3
TRC Version: 1 Clone ID:NM_014563.2-135s1c1
Sequence:CCGGGCCACCATGATAATCCAGTTTCTCGAGAAACTGGATTATCATGGTGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018939    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014563.2-185s1c1
Sequence:CCGGGCAGAATCCAAAGACGACCATCTCGAGATGGTCGTCTTTGGATTCTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018938    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014563.2-453s1c1
Sequence:CCGGCCAATTCTCCTATTCGATCAACTCGAGTTGATCGAATAGGAGAATTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018936    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014563.2-308s1c1
Sequence:CCGGGAGTGGTTTGTGTCGGCATTTCTCGAGAAATGCCGACACAAACCACTCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000018937    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014563.2-206s1c1
Sequence:CCGGCGTCATCTGAACCAGTTCATACTCGAGTATGAACTGGTTCAGATGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424046    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014563.5-653s21c1
Sequence:CCGGTGTATTCTCAGCTTATCTAAACTCGAGTTTAGATAAGCTGAGAATACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412401    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014563.5-292s21c1
Sequence:CCGGGCTATCGAACAACATGTACTTCTCGAGAAGTACATGTTGTTCGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000418169    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014563.5-750s21c1
Sequence:CCGGCCTTGTGAACAGTGTTATTTACTCGAGTAAATAACACTGTTCACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416288    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014563.5-710s21c1
Sequence:CCGGTTCTGTCTCATGTCACGTATCCTCGAGGATACGTGACATGAGACAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks