EMAIL THIS PAGE TO A FRIEND

TRAPPC2L

trafficking protein particle complex 2-like

Synonyms: HSPC176
UniProtKB ID: Q9UL33, B2R4M9, Q6ZTA7, Q9NZZ4
Gene ID:
Mouse(59005) trafficking protein particle complex 2-like
Rat(292074) trafficking protein particle complex 2-like
Zebrafish(445112) trafficking protein particle complex 2-like
domestic cat(101099420) trafficking protein particle complex 2-like
dog(479614) trafficking protein particle complex 2-like
chicken(415847) trafficking protein particle complex 2-like
cow(509955) trafficking protein particle complex 2-like
sheep(101108596) trafficking protein particle complex 2-like
domestic guinea pig(100732607) trafficking protein particle complex 2-like
naked mole-rat(101711009) trafficking protein particle complex 2-like
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016209 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016209 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016209 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021502 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021502 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021502 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016209 Rosetta Predictions human pricing
NM_001106193 Rosetta Predictions rat pricing
NM_021502 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016209 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107993 predicted 318
2 SASI_Hs01_00107994 predicted 233
3 SASI_Hs01_00107995 predicted 328
4 SASI_Hs01_00107996 predicted 263
5 SASI_Hs01_00107997 predicted 314
6 SASI_Hs01_00107998 predicted 236
7 SASI_Hs01_00107999 predicted 311
8 SASI_Hs01_00108000 predicted 261
9 SASI_Hs01_00108001 predicted 320
10 SASI_Hs01_00108002 predicted 362
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106193 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216548 predicted 301
2 SASI_Rn02_00216549 predicted 239
3 SASI_Rn02_00216550 predicted 272
4 SASI_Rn02_00216551 predicted 242
5 SASI_Rn02_00216552 predicted 291
6 SASI_Rn02_00216553 predicted 214
7 SASI_Rn02_00216554 predicted 249
8 SASI_Rn02_00216555 predicted 248
9 SASI_Rn02_00216556 predicted 246
10 SASI_Rn02_00216557 predicted 199
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021502 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198690 predicted 266
2 SASI_Mm01_00198691 predicted 251
3 SASI_Mm01_00198692 predicted 282
4 SASI_Mm01_00198693 predicted 218
5 SASI_Mm01_00198694 predicted 230
6 SASI_Mm01_00198695 predicted 320
7 SASI_Mm01_00198696 predicted 235
8 SASI_Mm01_00198698 predicted 290
9 SASI_Mm01_00198699 predicted 325
10 SASI_Mm02_00326214 predicted 217
11 SASI_Mm01_00198697 predicted 241
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016209
VALIDATED
TRAPPC2L MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 2-like
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000298640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016209.3-290s21c1
Sequence:CCGGGTTTGTCATGGTGGTAGATTCCTCGAGGAATCTACCACCATGACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016209.3-241s21c1
Sequence:CCGGCCACGGAGGACTACAAGGTATCTCGAGATACCTTGTAGTCCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000293992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016209.3-367s21c1
Sequence:CCGGACTCCTACACAGACGTGATGTCTCGAGACATCACGTCTGTGTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016209.3-125s21c1
Sequence:CCGGCGAGCTGAAGTTCCACTACATCTCGAGATGTAGTGGAACTTCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000286499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016209.3-321s21c1
Sequence:CCGGGCCCTTCGAGACAACGAAATTCTCGAGAATTTCGTTGTCTCGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016209.1-337s1c1
Sequence:CCGGCAACGAAATTCGCAGCATGTTCTCGAGAACATGCTGCGAATTTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016209.1-326s1c1
Sequence:CCGGGCCCTTCGAGACAACGAAATTCTCGAGAATTTCGTTGTCTCGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016209.1-459s1c1
Sequence:CCGGCGATGATGATACAGGTGTGCTCTCGAGAGCACACCTGTATCATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016209.1-268s1c1
Sequence:CCGGCGGCTACGTCACCAACTCCAACTCGAGTTGGAGTTGGTGACGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016209.1-130s1c1
Sequence:CCGGCGAGCTGAAGTTCCACTACATCTCGAGATGTAGTGGAACTTCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016209
VALIDATED
TRAPPC2L MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 2-like
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000298640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016209.3-290s21c1
Sequence:CCGGGTTTGTCATGGTGGTAGATTCCTCGAGGAATCTACCACCATGACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016209.3-241s21c1
Sequence:CCGGCCACGGAGGACTACAAGGTATCTCGAGATACCTTGTAGTCCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000293992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016209.3-367s21c1
Sequence:CCGGACTCCTACACAGACGTGATGTCTCGAGACATCACGTCTGTGTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016209.3-125s21c1
Sequence:CCGGCGAGCTGAAGTTCCACTACATCTCGAGATGTAGTGGAACTTCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000286499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016209.3-321s21c1
Sequence:CCGGGCCCTTCGAGACAACGAAATTCTCGAGAATTTCGTTGTCTCGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016209.1-337s1c1
Sequence:CCGGCAACGAAATTCGCAGCATGTTCTCGAGAACATGCTGCGAATTTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016209.1-326s1c1
Sequence:CCGGGCCCTTCGAGACAACGAAATTCTCGAGAATTTCGTTGTCTCGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016209.1-459s1c1
Sequence:CCGGCGATGATGATACAGGTGTGCTCTCGAGAGCACACCTGTATCATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016209.1-268s1c1
Sequence:CCGGCGGCTACGTCACCAACTCCAACTCGAGTTGGAGTTGGTGACGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016209.1-130s1c1
Sequence:CCGGCGAGCTGAAGTTCCACTACATCTCGAGATGTAGTGGAACTTCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016209
VALIDATED
TRAPPC2L MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 2-like
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000298640    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016209.3-290s21c1
Sequence:CCGGGTTTGTCATGGTGGTAGATTCCTCGAGGAATCTACCACCATGACAAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298644    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016209.3-241s21c1
Sequence:CCGGCCACGGAGGACTACAAGGTATCTCGAGATACCTTGTAGTCCTCCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000293992    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016209.3-367s21c1
Sequence:CCGGACTCCTACACAGACGTGATGTCTCGAGACATCACGTCTGTGTAGGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286498    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016209.3-125s21c1
Sequence:CCGGCGAGCTGAAGTTCCACTACATCTCGAGATGTAGTGGAACTTCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000286499    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_016209.3-321s21c1
Sequence:CCGGGCCCTTCGAGACAACGAAATTCTCGAGAATTTCGTTGTCTCGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059885    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016209.1-337s1c1
Sequence:CCGGCAACGAAATTCGCAGCATGTTCTCGAGAACATGCTGCGAATTTCGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059884    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016209.1-326s1c1
Sequence:CCGGGCCCTTCGAGACAACGAAATTCTCGAGAATTTCGTTGTCTCGAAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059886    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016209.1-459s1c1
Sequence:CCGGCGATGATGATACAGGTGTGCTCTCGAGAGCACACCTGTATCATCATCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016209.1-268s1c1
Sequence:CCGGCGGCTACGTCACCAACTCCAACTCGAGTTGGAGTTGGTGACGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059883    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016209.1-130s1c1
Sequence:CCGGCGAGCTGAAGTTCCACTACATCTCGAGATGTAGTGGAACTTCAGCTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021502
VALIDATED
TRAPPC2L MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 2-like
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000246565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021502.1-218s21c1
Sequence:CCGGACCGAGGACTACAAGGTATATCTCGAGATATACCTTGTAGTCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021502.1-274s21c1
Sequence:CCGGGGTCGTGGATTCCTCCAATACCTCGAGGTATTGGAGGAATCCACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021502.1-248s21c1
Sequence:CCGGACCAATTCCAAGGTGAAATTTCTCGAGAAATTTCACCTTGGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021502.1-305s21c1
Sequence:CCGGGACAACGAGATCCGCAGTATGCTCGAGCATACTGCGGATCTCGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021502.1-461s21c1
Sequence:CCGGGCCTGCCTCAGTCGTTCAGAACTCGAGTTCTGAACGACTGAGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000202272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021502.1-103s1c1
Sequence:CCGGGCTCAAGTTCCACTACATGGTCTCGAGACCATGTAGTGGAACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021502.1-328s1c1
Sequence:CCGGCCGGAAGCTGCATAACTCTTACTCGAGTAAGAGTTATGCAGCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021502
VALIDATED
TRAPPC2L MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 2-like
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000246565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021502.1-218s21c1
Sequence:CCGGACCGAGGACTACAAGGTATATCTCGAGATATACCTTGTAGTCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021502.1-274s21c1
Sequence:CCGGGGTCGTGGATTCCTCCAATACCTCGAGGTATTGGAGGAATCCACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021502.1-248s21c1
Sequence:CCGGACCAATTCCAAGGTGAAATTTCTCGAGAAATTTCACCTTGGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021502.1-305s21c1
Sequence:CCGGGACAACGAGATCCGCAGTATGCTCGAGCATACTGCGGATCTCGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021502.1-461s21c1
Sequence:CCGGGCCTGCCTCAGTCGTTCAGAACTCGAGTTCTGAACGACTGAGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000202272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021502.1-103s1c1
Sequence:CCGGGCTCAAGTTCCACTACATGGTCTCGAGACCATGTAGTGGAACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021502.1-328s1c1
Sequence:CCGGCCGGAAGCTGCATAACTCTTACTCGAGTAAGAGTTATGCAGCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021502
VALIDATED
TRAPPC2L MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 2-like
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000246565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021502.1-218s21c1
Sequence:CCGGACCGAGGACTACAAGGTATATCTCGAGATATACCTTGTAGTCCTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.7 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021502.1-274s21c1
Sequence:CCGGGGTCGTGGATTCCTCCAATACCTCGAGGTATTGGAGGAATCCACGACCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.87 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021502.1-248s21c1
Sequence:CCGGACCAATTCCAAGGTGAAATTTCTCGAGAAATTTCACCTTGGAATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246562    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021502.1-305s21c1
Sequence:CCGGGACAACGAGATCCGCAGTATGCTCGAGCATACTGCGGATCTCGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246561    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_021502.1-461s21c1
Sequence:CCGGGCCTGCCTCAGTCGTTCAGAACTCGAGTTCTGAACGACTGAGGCAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000202272    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021502.1-103s1c1
Sequence:CCGGGCTCAAGTTCCACTACATGGTCTCGAGACCATGTAGTGGAACTTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190180    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021502.1-328s1c1
Sequence:CCGGCCGGAAGCTGCATAACTCTTACTCGAGTAAGAGTTATGCAGCTTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks