EMAIL THIS PAGE TO A FRIEND

TRAPPC3

trafficking protein particle complex 3

Synonyms: BET3
UniProtKB ID: O43617, A6NDN0, B2RDN2, D3DPS2
Gene ID:
Human(27095) Summary: This gene encodes a component of the trafficking protein particle complex, which tethers transport vesicles to the cis-Golgi membrane. The encoded protein participates in the regulation of transport from the endoplasmic reticulum to the Golgi apparatus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
Mouse(27096) trafficking protein particle complex 3
Rat(362599) trafficking protein particle complex 3
Zebrafish(445207) trafficking protein particle complex 3
dog(482477) trafficking protein particle complex 3
domestic cat(101088011) trafficking protein particle complex 3
chicken(419625) trafficking protein particle complex 3
naked mole-rat(101718690) trafficking protein particle complex 3
domestic guinea pig(100716921) trafficking protein particle complex 3
cow(538669) trafficking protein particle complex 3
sheep(101112011) trafficking protein particle complex 3
93 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013718 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013718 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013718 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_014408 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014408 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014408 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014408 Rosetta Predictions human pricing
NM_001008376 Rosetta Predictions rat pricing
NM_013718 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014408 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016666 predicted 712
2 SASI_Hs01_00016667 predicted 251
3 SASI_Hs01_00016668 predicted 715
4 SASI_Hs01_00016669 predicted 868
5 SASI_Hs01_00016670 predicted 714
6 SASI_Hs01_00016671 predicted 233
7 SASI_Hs01_00016672 predicted 855
8 SASI_Hs01_00016673 predicted 711
9 SASI_Hs01_00016674 predicted 701
10 SASI_Hs01_00016675 predicted 863
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001008376 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00199151 predicted 362
2 SASI_Rn01_00115173 predicted 274
3 SASI_Rn01_00115174 predicted 342
4 SASI_Rn01_00115175 predicted 431
5 SASI_Rn01_00115176 predicted 962
6 SASI_Rn01_00115177 predicted 837
7 SASI_Rn01_00115178 predicted 700
8 SASI_Rn01_00115179 predicted 929
9 SASI_Rn01_00115180 predicted 208
10 SASI_Rn01_00115181 predicted 258
11 SASI_Rn01_00115182 predicted 552
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013718 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00322633 predicted 754
2 SASI_Mm01_00136953 predicted 428
3 SASI_Mm01_00136954 predicted 282
4 SASI_Mm01_00136955 predicted 989
5 SASI_Mm01_00136956 predicted 857
6 SASI_Mm01_00136957 predicted 386
7 SASI_Mm01_00136958 predicted 364
8 SASI_Mm01_00136959 predicted 876
9 SASI_Mm01_00136960 predicted 584
10 SASI_Mm01_00136961 predicted 566
11 SASI_Mm01_00136962 predicted 981
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013718
VALIDATED
TRAPPC3 MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 3
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201097    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013718.2-804s1c1
Sequence:CCGGCCACAAATATGCACCTCAGAACTCGAGTTCTGAGGTGCATATTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013718.2-246s1c1
Sequence:CCGGGAGTCCGACTGATTGAAGATTCTCGAGAATCTTCAATCAGTCGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013718.2-240s21c1
Sequence:CCGGACATTGGAGTCCGACTGATTGCTCGAGCAATCAGTCGGACTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013718.2-433s21c1
Sequence:CCGGCTTTGTGGAGCTTCCCGATAACTCGAGTTATCGGGAAGCTCCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013718.2-867s21c1
Sequence:CCGGCTTGCCCTTGGTTGGACTAAGCTCGAGCTTAGTCCAACCAAGGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013718.2-224s1c1
Sequence:CCGGGACAGAATGGGCTACAACATTCTCGAGAATGTTGTAGCCCATTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013718.2-304s21c1
Sequence:CCGGTCGGGAAACTGCAGATGTTATCTCGAGATAACATCTGCAGTTTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013718.2-559s21c1
Sequence:CCGGGGGAGATGGCGTGACAGAAATCTCGAGATTTCTGTCACGCCATCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013718
VALIDATED
TRAPPC3 MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 3
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201097    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013718.2-804s1c1
Sequence:CCGGCCACAAATATGCACCTCAGAACTCGAGTTCTGAGGTGCATATTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013718.2-246s1c1
Sequence:CCGGGAGTCCGACTGATTGAAGATTCTCGAGAATCTTCAATCAGTCGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013718.2-240s21c1
Sequence:CCGGACATTGGAGTCCGACTGATTGCTCGAGCAATCAGTCGGACTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013718.2-433s21c1
Sequence:CCGGCTTTGTGGAGCTTCCCGATAACTCGAGTTATCGGGAAGCTCCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013718.2-867s21c1
Sequence:CCGGCTTGCCCTTGGTTGGACTAAGCTCGAGCTTAGTCCAACCAAGGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013718.2-224s1c1
Sequence:CCGGGACAGAATGGGCTACAACATTCTCGAGAATGTTGTAGCCCATTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013718.2-304s21c1
Sequence:CCGGTCGGGAAACTGCAGATGTTATCTCGAGATAACATCTGCAGTTTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013718.2-559s21c1
Sequence:CCGGGGGAGATGGCGTGACAGAAATCTCGAGATTTCTGTCACGCCATCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013718
VALIDATED
TRAPPC3 MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 3
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201097    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_013718.2-804s1c1
Sequence:CCGGCCACAAATATGCACCTCAGAACTCGAGTTCTGAGGTGCATATTTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192939    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013718.2-246s1c1
Sequence:CCGGGAGTCCGACTGATTGAAGATTCTCGAGAATCTTCAATCAGTCGGACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013718.2-240s21c1
Sequence:CCGGACATTGGAGTCCGACTGATTGCTCGAGCAATCAGTCGGACTCCAATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257934    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013718.2-433s21c1
Sequence:CCGGCTTTGTGGAGCTTCCCGATAACTCGAGTTATCGGGAAGCTCCACAAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249605    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.53 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013718.2-867s21c1
Sequence:CCGGCTTGCCCTTGGTTGGACTAAGCTCGAGCTTAGTCCAACCAAGGGCAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217663    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_013718.2-224s1c1
Sequence:CCGGGACAGAATGGGCTACAACATTCTCGAGAATGTTGTAGCCCATTCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249606    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013718.2-304s21c1
Sequence:CCGGTCGGGAAACTGCAGATGTTATCTCGAGATAACATCTGCAGTTTCCCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249604    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_013718.2-559s21c1
Sequence:CCGGGGGAGATGGCGTGACAGAAATCTCGAGATTTCTGTCACGCCATCTCCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014408
VALIDATED
TRAPPC3 MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 3
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000059563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014408.3-443s1c1
Sequence:CCGGCCTGATAACCACTCATCCCTTCTCGAGAAGGGATGAGTGGTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014408.3-351s1c1
Sequence:CCGGGCATCACTCCAAGCATTACTACTCGAGTAGTAATGCTTGGAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014408.3-172s1c1
Sequence:CCGGCCAGCTATGTAAGGACTATGACTCGAGTCATAGTCCTTACATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014408.3-580s1c1
Sequence:CCGGGATGAGATTCATCAGGCGGATCTCGAGATCCGCCTGATGAATCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014408.3-247s1c1
Sequence:CCGGCCGGCTGATTGAAGATTTCTTCTCGAGAAGAAATCTTCAATCAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014408.3-172s21c1
Sequence:CCGGCCAGCTATGTAAGGACTATGACTCGAGTCATAGTCCTTACATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014408.3-247s21c1
Sequence:CCGGCCGGCTGATTGAAGATTTCTTCTCGAGAAGAAATCTTCAATCAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014408.3-580s21c1
Sequence:CCGGGATGAGATTCATCAGGCGGATCTCGAGATCCGCCTGATGAATCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_014408.3-443s21c1
Sequence:CCGGCCTGATAACCACTCATCCCTTCTCGAGAAGGGATGAGTGGTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000291612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014408.3-351s21c1
Sequence:CCGGGCATCACTCCAAGCATTACTACTCGAGTAGTAATGCTTGGAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014408
VALIDATED
TRAPPC3 MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 3
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000059563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014408.3-443s1c1
Sequence:CCGGCCTGATAACCACTCATCCCTTCTCGAGAAGGGATGAGTGGTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014408.3-351s1c1
Sequence:CCGGGCATCACTCCAAGCATTACTACTCGAGTAGTAATGCTTGGAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014408.3-172s1c1
Sequence:CCGGCCAGCTATGTAAGGACTATGACTCGAGTCATAGTCCTTACATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014408.3-580s1c1
Sequence:CCGGGATGAGATTCATCAGGCGGATCTCGAGATCCGCCTGATGAATCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014408.3-247s1c1
Sequence:CCGGCCGGCTGATTGAAGATTTCTTCTCGAGAAGAAATCTTCAATCAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014408.3-172s21c1
Sequence:CCGGCCAGCTATGTAAGGACTATGACTCGAGTCATAGTCCTTACATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014408.3-247s21c1
Sequence:CCGGCCGGCTGATTGAAGATTTCTTCTCGAGAAGAAATCTTCAATCAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014408.3-580s21c1
Sequence:CCGGGATGAGATTCATCAGGCGGATCTCGAGATCCGCCTGATGAATCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_014408.3-443s21c1
Sequence:CCGGCCTGATAACCACTCATCCCTTCTCGAGAAGGGATGAGTGGTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000291612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014408.3-351s21c1
Sequence:CCGGGCATCACTCCAAGCATTACTACTCGAGTAGTAATGCTTGGAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014408
VALIDATED
TRAPPC3 MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 3
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000059563    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_014408.3-443s1c1
Sequence:CCGGCCTGATAACCACTCATCCCTTCTCGAGAAGGGATGAGTGGTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059565    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_014408.3-351s1c1
Sequence:CCGGGCATCACTCCAAGCATTACTACTCGAGTAGTAATGCTTGGAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059567    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 1 Clone ID:NM_014408.3-172s1c1
Sequence:CCGGCCAGCTATGTAAGGACTATGACTCGAGTCATAGTCCTTACATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059566    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A549
TRC Version: 1 Clone ID:NM_014408.3-580s1c1
Sequence:CCGGGATGAGATTCATCAGGCGGATCTCGAGATCCGCCTGATGAATCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059564    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.86 Cell Line: A549
TRC Version: 1 Clone ID:NM_014408.3-247s1c1
Sequence:CCGGCCGGCTGATTGAAGATTTCTTCTCGAGAAGAAATCTTCAATCAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291610    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: A549
TRC Version: 2 Clone ID:NM_014408.3-172s21c1
Sequence:CCGGCCAGCTATGTAAGGACTATGACTCGAGTCATAGTCCTTACATAGCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014408.3-247s21c1
Sequence:CCGGCCGGCTGATTGAAGATTTCTTCTCGAGAAGAAATCTTCAATCAGCCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291613    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 2 Clone ID:NM_014408.3-580s21c1
Sequence:CCGGGATGAGATTCATCAGGCGGATCTCGAGATCCGCCTGATGAATCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291555    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: A549
TRC Version: 2 Clone ID:NM_014408.3-443s21c1
Sequence:CCGGCCTGATAACCACTCATCCCTTCTCGAGAAGGGATGAGTGGTTATCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000291612    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: A549
TRC Version: 2 Clone ID:NM_014408.3-351s21c1
Sequence:CCGGGCATCACTCCAAGCATTACTACTCGAGTAGTAATGCTTGGAGTGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks