EMAIL THIS PAGE TO A FRIEND

TRAPPC3L

trafficking protein particle complex 3-like

Synonyms: BET3L bA259P20.2
UniProtKB ID: Q5T215, Q5T213, Q5T214
Gene ID:
Mouse(692132) trafficking protein particle complex 3 like
domestic guinea pig(100722884) trafficking protein particle complex 3-like
naked mole-rat(101705281) trafficking protein particle complex 3-like
39 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301063 ANTI-BET3L (N-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
flow cytometry, immunohistochemistry, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_001139444 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001139444 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001139444 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU152391 MISSION® esiRNA esiRNA human BET3L (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
XM_001723259 Rosetta Predictions human pricing
XM_001725041 Rosetta Predictions human pricing
XM_001726393 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001723259 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00454293 predicted 524
2 SASI_Hs02_00454294 predicted 200
3 SASI_Hs02_00454295 predicted 201
4 SASI_Hs02_00454296 predicted 578
5 SASI_Hs02_00454297 predicted 179
6 SASI_Hs02_00454298 predicted 725
7 SASI_Hs02_00454299 predicted 202
8 SASI_Hs02_00454300 predicted 903
9 SASI_Hs02_00454301 predicted 294
10 SASI_Hs02_00454302 predicted 676
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001725041 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00465209 predicted 537
2 SASI_Hs02_00465210 predicted 360
3 SASI_Hs02_00465211 predicted 267
4 SASI_Hs02_00465212 predicted 205
5 SASI_Hs02_00465213 predicted 289
6 SASI_Hs02_00465214 predicted 524
7 SASI_Hs02_00465215 predicted 370
8 SASI_Hs02_00465216 predicted 200
9 SASI_Hs02_00465217 predicted 506
10 SASI_Hs02_00465218 predicted 567
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001726393 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00474006 predicted 534
2 SASI_Hs02_00474007 predicted 365
3 SASI_Hs02_00474008 predicted 275
4 SASI_Hs02_00474009 predicted 208
5 SASI_Hs02_00474010 predicted 288
6 SASI_Hs02_00474011 predicted 519
7 SASI_Hs02_00474012 predicted 367
8 SASI_Hs02_00474013 predicted 207
9 SASI_Hs02_00474014 predicted 506
10 SASI_Hs02_00474015 predicted 561
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001139444
TRAPPC3L MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 3-like
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000256795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139444.1-207s21c1
Sequence:CCGGTGAAGATGTGAACCAATATTTCTCGAGAAATATTGGTTCACATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139444.1-368s21c1
Sequence:CCGGCAAGTGTGACCTGTAACAATTCTCGAGAATTGTTACAGGTCACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139444.1-290s21c1
Sequence:CCGGTGGGAAGATGCCATAGTTATTCTCGAGAATAACTATGGCATCTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001139444.1-810s21c1
Sequence:CCGGTTGCTTATAAATCACGCATTTCTCGAGAAATGCGTGATTTATAAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000256796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139444.1-529s21c1
Sequence:CCGGTTGGCGGCTGATGTTACATTCCTCGAGGAATGTAACATCAGCCGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001139444
TRAPPC3L MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 3-like
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000256795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139444.1-207s21c1
Sequence:CCGGTGAAGATGTGAACCAATATTTCTCGAGAAATATTGGTTCACATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139444.1-368s21c1
Sequence:CCGGCAAGTGTGACCTGTAACAATTCTCGAGAATTGTTACAGGTCACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139444.1-290s21c1
Sequence:CCGGTGGGAAGATGCCATAGTTATTCTCGAGAATAACTATGGCATCTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001139444.1-810s21c1
Sequence:CCGGTTGCTTATAAATCACGCATTTCTCGAGAAATGCGTGATTTATAAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000256796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139444.1-529s21c1
Sequence:CCGGTTGGCGGCTGATGTTACATTCCTCGAGGAATGTAACATCAGCCGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001139444
TRAPPC3L MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 3-like
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000256795    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139444.1-207s21c1
Sequence:CCGGTGAAGATGTGAACCAATATTTCTCGAGAAATATTGGTTCACATCTTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256797    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139444.1-368s21c1
Sequence:CCGGCAAGTGTGACCTGTAACAATTCTCGAGAATTGTTACAGGTCACACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256798    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139444.1-290s21c1
Sequence:CCGGTGGGAAGATGCCATAGTTATTCTCGAGAATAACTATGGCATCTTCCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256799    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001139444.1-810s21c1
Sequence:CCGGTTGCTTATAAATCACGCATTTCTCGAGAAATGCGTGATTTATAAGCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000256796    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001139444.1-529s21c1
Sequence:CCGGTTGGCGGCTGATGTTACATTCCTCGAGGAATGTAACATCAGCCGCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks