EMAIL THIS PAGE TO A FRIEND

TRAPPC4

trafficking protein particle complex 4

Synonyms: HSPC172 PTD009 SBDN SYNBINDIN TRS23
UniProtKB ID: Q9Y296, A8K3A5
Gene ID:
Mouse(60409) trafficking protein particle complex 4
Rat(367073) trafficking protein particle complex 4
Zebrafish(393737) trafficking protein particle complex 4
chicken(419788) trafficking protein particle complex 4
domestic cat(101094127) trafficking protein particle complex 4
dog(479411) trafficking protein particle complex 4
naked mole-rat(101696918) trafficking protein particle complex 4
domestic guinea pig(100722363) trafficking protein particle complex 4
cow(504391) trafficking protein particle complex 4
cow(785345) trafficking protein particle complex 4
sheep(101105101) trafficking protein particle complex 4
70 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016146 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016146 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016146 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021789 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021789 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021789 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016146 Rosetta Predictions human pricing
NM_001003708 Rosetta Predictions rat pricing
XM_579105 Rosetta Predictions rat pricing
NM_021789 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016146 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00135072 predicted 668
2 SASI_Hs01_00135073 predicted 703
3 SASI_Hs02_00348945 predicted 834
4 SASI_Hs01_00135074 predicted 672
5 SASI_Hs01_00135076 predicted 755
6 SASI_Hs01_00135077 predicted 477
7 SASI_Hs02_00348946 predicted 486
8 SASI_Hs01_00135081 predicted 769
9 SASI_Hs02_00348947 predicted 688
10 SASI_Hs02_00348948 predicted 767
11 SASI_Hs01_00135075 predicted 789
12 SASI_Hs01_00135078 predicted 700
13 SASI_Hs01_00135079 predicted 830
14 SASI_Hs01_00135080 predicted 664
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001003708 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00117986 predicted 256
2 SASI_Rn01_00117987 predicted 322
3 SASI_Rn01_00117988 predicted 381
4 SASI_Rn01_00117989 predicted 302
5 SASI_Rn01_00117990 predicted 259
6 SASI_Rn01_00117991 predicted 355
7 SASI_Rn01_00117992 predicted 606
8 SASI_Rn01_00117993 predicted 573
9 SASI_Rn01_00117994 predicted 538
10 SASI_Rn02_00198057 predicted 436
11 SASI_Rn01_00117995 predicted 630
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579105 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00165857 predicted 329
2 SASI_Rn01_00165858 predicted 392
3 SASI_Rn01_00165859 predicted 309
4 SASI_Rn01_00165860 predicted 274
5 SASI_Rn01_00165861 predicted 363
6 SASI_Rn01_00165862 predicted 619
7 SASI_Rn01_00165863 predicted 572
8 SASI_Rn01_00165864 predicted 541
9 SASI_Rn01_00165865 predicted 623
10 SASI_Rn01_00165866 predicted 449
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021789 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00326424 predicted 773
2 SASI_Mm01_00151981 predicted 562
3 SASI_Mm01_00151982 predicted 635
4 SASI_Mm02_00326425 predicted 481
5 SASI_Mm02_00326426 predicted 256
6 SASI_Mm02_00326427 predicted 279
7 SASI_Mm02_00326428 predicted 907
8 SASI_Mm02_00326429 predicted 908
9 SASI_Mm01_00151990 predicted 916
10 SASI_Mm02_00326430 predicted 634
11 SASI_Mm01_00151983 predicted 327
12 SASI_Mm01_00151984 predicted 609
13 SASI_Mm01_00151985 predicted 473
14 SASI_Mm01_00151986 predicted 788
15 SASI_Mm01_00151987 predicted 694
16 SASI_Mm01_00151988 predicted 452
17 SASI_Mm01_00151989 predicted 660
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016146
VALIDATED
TRAPPC4 MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 4
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000445541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016146.4-603s21c1
Sequence:CCAGCCATGTTCCACTCGCTCTTTGCTCGAGCAAAGAGCGAGTGGAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016146.4-677s21c1
Sequence:CCGGGAGACAGACACATTCAAATTGCTCGAGCAATTTGAATGTGTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016146.4-462s21c1
Sequence:CCGGTCAATGGCATGGACGTGAATGCTCGAGCATTCACGTCCATGCCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016146.4-743s21c1
Sequence:CCGGGATCCTAGGCAAGCTGGAATACTCGAGTATTCCAGCTTGCCTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016146.4-540s21c1
Sequence:CCGGACCCGGTGTCCATTCGATTTGCTCGAGCAAATCGAATGGACACCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_016146.1-560s1c1
Sequence:CCGGCCGCCTCACTTCTAATGAGAACTCGAGTTCTCATTAGAAGTGAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155702    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016146.1-1037s1c1
Sequence:CCGGCCCTGATGACTTGTACTGATTCTCGAGAATCAGTACAAGTCATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016146.1-820s1c1
Sequence:CCGGCCTTAGAAATGCCTATCAGGTCTCGAGACCTGATAGGCATTTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000154709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016146.1-1001s1c1
Sequence:CCGGGCCTTGTTAGTGCACTTGAAACTCGAGTTTCAAGTGCACTAACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000155101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016146.1-798s1c1
Sequence:CCGGGCCCTCAAGAATCCATTCTATCTCGAGATAGAATGGATTCTTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016146.1-509s1c1
Sequence:CCGGGTATCTGGGTAACCCTGCTAACTCGAGTTAGCAGGGTTACCCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000156859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016146.1-665s1c1
Sequence:CCGGGCTGGAGACAGACACATTCAACTCGAGTTGAATGTGTCTGTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000157220    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016146.1-1061s1c1
Sequence:CCGGGAGCCTTAACACTGTGCTCTTCTCGAGAAGAGCACAGTGTTAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016146
VALIDATED
TRAPPC4 MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 4
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000445541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016146.4-603s21c1
Sequence:CCAGCCATGTTCCACTCGCTCTTTGCTCGAGCAAAGAGCGAGTGGAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016146.4-677s21c1
Sequence:CCGGGAGACAGACACATTCAAATTGCTCGAGCAATTTGAATGTGTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016146.4-462s21c1
Sequence:CCGGTCAATGGCATGGACGTGAATGCTCGAGCATTCACGTCCATGCCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016146.4-743s21c1
Sequence:CCGGGATCCTAGGCAAGCTGGAATACTCGAGTATTCCAGCTTGCCTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016146.4-540s21c1
Sequence:CCGGACCCGGTGTCCATTCGATTTGCTCGAGCAAATCGAATGGACACCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_016146.1-560s1c1
Sequence:CCGGCCGCCTCACTTCTAATGAGAACTCGAGTTCTCATTAGAAGTGAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155702    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016146.1-1037s1c1
Sequence:CCGGCCCTGATGACTTGTACTGATTCTCGAGAATCAGTACAAGTCATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016146.1-820s1c1
Sequence:CCGGCCTTAGAAATGCCTATCAGGTCTCGAGACCTGATAGGCATTTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000154709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016146.1-1001s1c1
Sequence:CCGGGCCTTGTTAGTGCACTTGAAACTCGAGTTTCAAGTGCACTAACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000155101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016146.1-798s1c1
Sequence:CCGGGCCCTCAAGAATCCATTCTATCTCGAGATAGAATGGATTCTTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016146.1-509s1c1
Sequence:CCGGGTATCTGGGTAACCCTGCTAACTCGAGTTAGCAGGGTTACCCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000156859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016146.1-665s1c1
Sequence:CCGGGCTGGAGACAGACACATTCAACTCGAGTTGAATGTGTCTGTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000157220    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016146.1-1061s1c1
Sequence:CCGGGAGCCTTAACACTGTGCTCTTCTCGAGAAGAGCACAGTGTTAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016146
VALIDATED
TRAPPC4 MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 4
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000445541    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016146.4-603s21c1
Sequence:CCAGCCATGTTCCACTCGCTCTTTGCTCGAGCAAAGAGCGAGTGGAACATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016146.4-677s21c1
Sequence:CCGGGAGACAGACACATTCAAATTGCTCGAGCAATTTGAATGTGTCTGTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016146.4-462s21c1
Sequence:CCGGTCAATGGCATGGACGTGAATGCTCGAGCATTCACGTCCATGCCATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423353    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016146.4-743s21c1
Sequence:CCGGGATCCTAGGCAAGCTGGAATACTCGAGTATTCCAGCTTGCCTAGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437883    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016146.4-540s21c1
Sequence:CCGGACCCGGTGTCCATTCGATTTGCTCGAGCAAATCGAATGGACACCGGGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156463    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.63 Cell Line: A549
TRC Version: 1 Clone ID:NM_016146.1-560s1c1
Sequence:CCGGCCGCCTCACTTCTAATGAGAACTCGAGTTCTCATTAGAAGTGAGGCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155702    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.98 Cell Line: A549
TRC Version: 1 Clone ID:NM_016146.1-1037s1c1
Sequence:CCGGCCCTGATGACTTGTACTGATTCTCGAGAATCAGTACAAGTCATCAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156004    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016146.1-820s1c1
Sequence:CCGGCCTTAGAAATGCCTATCAGGTCTCGAGACCTGATAGGCATTTCTAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000154709    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_016146.1-1001s1c1
Sequence:CCGGGCCTTGTTAGTGCACTTGAAACTCGAGTTTCAAGTGCACTAACAAGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000155101    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: A549
TRC Version: 1 Clone ID:NM_016146.1-798s1c1
Sequence:CCGGGCCCTCAAGAATCCATTCTATCTCGAGATAGAATGGATTCTTGAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157568    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: A549
TRC Version: 1 Clone ID:NM_016146.1-509s1c1
Sequence:CCGGGTATCTGGGTAACCCTGCTAACTCGAGTTAGCAGGGTTACCCAGATACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000156859    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016146.1-665s1c1
Sequence:CCGGGCTGGAGACAGACACATTCAACTCGAGTTGAATGTGTCTGTCTCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000157220    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_016146.1-1061s1c1
Sequence:CCGGGAGCCTTAACACTGTGCTCTTCTCGAGAAGAGCACAGTGTTAAGGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021789
VALIDATED
TRAPPC4 MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 4
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000354048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021789.2-810s21c1
Sequence:CCGGCCTTGGAAATGCCTATCAGATCTCGAGATCTGATAGGCATTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021789.2-729s21c1
Sequence:CCGGCTAGGCAAGCTGGAATAGATTCTCGAGAATCTATTCCAGCTTGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021789.2-994s21c1
Sequence:CCGGGCCTTGCTAATATACTTGAAACTCGAGTTTCAAGTATATTAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000325455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021789.2-553s21c1
Sequence:CCGGCCTTACCTCTAACGAGAAGCTCTCGAGAGCTTCTCGTTAGAGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021789.2-553s1c1
Sequence:CCGGCCTTACCTCTAACGAGAAGCTCTCGAGAGCTTCTCGTTAGAGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021789.2-550s1c1
Sequence:CCGGCCGCCTTACCTCTAACGAGAACTCGAGTTCTCGTTAGAGGTAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021789.2-729s1c1
Sequence:CCGGCTAGGCAAGCTGGAATAGATTCTCGAGAATCTATTCCAGCTTGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021789.2-810s1c1
Sequence:CCGGCCTTGGAAATGCCTATCAGATCTCGAGATCTGATAGGCATTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021789.2-994s1c1
Sequence:CCGGGCCTTGCTAATATACTTGAAACTCGAGTTTCAAGTATATTAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021789
VALIDATED
TRAPPC4 MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 4
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000354048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021789.2-810s21c1
Sequence:CCGGCCTTGGAAATGCCTATCAGATCTCGAGATCTGATAGGCATTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021789.2-729s21c1
Sequence:CCGGCTAGGCAAGCTGGAATAGATTCTCGAGAATCTATTCCAGCTTGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021789.2-994s21c1
Sequence:CCGGGCCTTGCTAATATACTTGAAACTCGAGTTTCAAGTATATTAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000325455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021789.2-553s21c1
Sequence:CCGGCCTTACCTCTAACGAGAAGCTCTCGAGAGCTTCTCGTTAGAGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021789.2-553s1c1
Sequence:CCGGCCTTACCTCTAACGAGAAGCTCTCGAGAGCTTCTCGTTAGAGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021789.2-550s1c1
Sequence:CCGGCCGCCTTACCTCTAACGAGAACTCGAGTTCTCGTTAGAGGTAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021789.2-729s1c1
Sequence:CCGGCTAGGCAAGCTGGAATAGATTCTCGAGAATCTATTCCAGCTTGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021789.2-810s1c1
Sequence:CCGGCCTTGGAAATGCCTATCAGATCTCGAGATCTGATAGGCATTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021789.2-994s1c1
Sequence:CCGGGCCTTGCTAATATACTTGAAACTCGAGTTTCAAGTATATTAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021789
VALIDATED
TRAPPC4 MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 4
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000354048    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021789.2-810s21c1
Sequence:CCGGCCTTGGAAATGCCTATCAGATCTCGAGATCTGATAGGCATTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325392    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021789.2-729s21c1
Sequence:CCGGCTAGGCAAGCTGGAATAGATTCTCGAGAATCTATTCCAGCTTGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325391    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021789.2-994s21c1
Sequence:CCGGGCCTTGCTAATATACTTGAAACTCGAGTTTCAAGTATATTAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000325455    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021789.2-553s21c1
Sequence:CCGGCCTTACCTCTAACGAGAAGCTCTCGAGAGCTTCTCGTTAGAGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100673    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021789.2-553s1c1
Sequence:CCGGCCTTACCTCTAACGAGAAGCTCTCGAGAGCTTCTCGTTAGAGGTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021789.2-550s1c1
Sequence:CCGGCCGCCTTACCTCTAACGAGAACTCGAGTTCTCGTTAGAGGTAAGGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100672    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.98 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021789.2-729s1c1
Sequence:CCGGCTAGGCAAGCTGGAATAGATTCTCGAGAATCTATTCCAGCTTGCCTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100671    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.83 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021789.2-810s1c1
Sequence:CCGGCCTTGGAAATGCCTATCAGATCTCGAGATCTGATAGGCATTTCCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100670    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.99 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_021789.2-994s1c1
Sequence:CCGGGCCTTGCTAATATACTTGAAACTCGAGTTTCAAGTATATTAGCAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks