EMAIL THIS PAGE TO A FRIEND

TRAPPC5

trafficking protein particle complex 5

Synonyms: TRS31
UniProtKB ID: Q8IUR0, A8K7I6
Gene ID:
Mouse(66682) trafficking protein particle complex 5
Rat(363858) trafficking protein particle complex 5
cow(504874) trafficking protein particle complex 5
sheep(101123116) trafficking protein particle complex 5
domestic guinea pig(100720610) trafficking protein particle complex 5
naked mole-rat(101705506) trafficking protein particle complex 5
Zebrafish(436755) trafficking protein particle complex 5
chicken(100858483) trafficking protein particle complex 5
dog(484997) trafficking protein particle complex 5
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025701 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025701 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025701 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_001042461 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_001042461 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_001042461 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001042461 Rosetta Predictions human pricing
NM_001042462 Rosetta Predictions human pricing
NM_174894 Rosetta Predictions human pricing
NM_001108850 Rosetta Predictions rat pricing
XM_344066 Rosetta Predictions rat pricing
NM_025701 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042461 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309898 predicted 515
2 SASI_Hs02_00309899 predicted 510
3 SASI_Hs02_00309900 predicted 514
4 SASI_Hs02_00309901 predicted 437
5 SASI_Hs02_00309902 predicted 428
6 SASI_Hs02_00309903 predicted 489
7 SASI_Hs02_00309904 predicted 491
8 SASI_Hs02_00309905 predicted 521
9 SASI_Hs02_00309906 predicted 490
10 SASI_Hs02_00309907 predicted 523
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001042462 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00309908 predicted 471
2 SASI_Hs02_00309909 predicted 485
3 SASI_Hs02_00309910 predicted 551
4 SASI_Hs02_00309911 predicted 475
5 SASI_Hs02_00309912 predicted 469
6 SASI_Hs02_00309913 predicted 554
7 SASI_Hs02_00309914 predicted 305
8 SASI_Hs02_00309915 predicted 533
9 SASI_Hs02_00309916 predicted 311
10 SASI_Hs02_00309917 predicted 566
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_174894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00368771 predicted 537
2 SASI_Hs02_00368772 predicted 543
3 SASI_Hs02_00368773 predicted 538
4 SASI_Hs02_00368774 predicted 461
5 SASI_Hs02_00368775 predicted 458
6 SASI_Hs02_00368776 predicted 520
7 SASI_Hs02_00368777 predicted 517
8 SASI_Hs02_00368778 predicted 543
9 SASI_Hs02_00368779 predicted 514
10 SASI_Hs02_00368780 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108850 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00242695 predicted 762
2 SASI_Rn02_00242696 predicted 591
3 SASI_Rn02_00242697 predicted 706
4 SASI_Rn02_00242698 predicted 981
5 SASI_Rn02_00242699 predicted 572
6 SASI_Rn02_00242700 predicted 821
7 SASI_Rn02_00242701 predicted 907
8 SASI_Rn02_00242702 predicted 642
9 SASI_Rn02_00242703 predicted 441
10 SASI_Rn02_00242704 predicted 475
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_344066 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00135445 predicted 1027
2 SASI_Rn01_00135446 predicted 856
3 SASI_Rn01_00135447 predicted 984
4 SASI_Rn01_00135448 predicted 1256
5 SASI_Rn01_00135449 predicted 1177
6 SASI_Rn01_00135450 predicted 367
7 SASI_Rn01_00135451 predicted 260
8 SASI_Rn01_00135452 predicted 911
9 SASI_Rn01_00135453 predicted 1226
10 SASI_Rn01_00135454 predicted 714
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025701 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00328869 predicted 919
2 SASI_Mm02_00328870 predicted 727
3 SASI_Mm01_00020287 predicted 726
4 SASI_Mm01_00020289 predicted 1015
5 SASI_Mm01_00020288 predicted 437
6 SASI_Mm02_00328871 predicted 1018
7 SASI_Mm01_00020291 predicted 505
8 SASI_Mm01_00020292 predicted 383
9 SASI_Mm01_00020294 predicted 928
10 SASI_Mm01_00020295 predicted 893
11 SASI_Mm01_00020286 predicted 606
12 SASI_Mm01_00020290 predicted 393
13 SASI_Mm01_00020293 predicted 569
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025701
VALIDATED
TRAPPC5 MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 5
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201674    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025701.2-1012s1c1
Sequence:CCGGGCCGTGGGTTTGATTCCTTATCTCGAGATAAGGAATCAAACCCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025701.2-495s1c1
Sequence:CCGGCAAGGAGAACAGCACACTGAACTCGAGTTCAGTGTGCTGTTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025701.2-465s1c1
Sequence:CCGGGCCGCTCATTAACACCTACATCTCGAGATGTAGGTGTTAATGAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025701.4-499s21c1
Sequence:CCGGGCCGCTCATTAACACCTACATCTCGAGATGTAGGTGTTAATGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025701.4-1068s21c1
Sequence:CCGGCCACATAAAGTGGGTACAAATCTCGAGATTTGTACCCACTTTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025701.4-268s21c1
Sequence:CCGGTTTCTCTGTGGCCGAGCTTCACTCGAGTGAAGCTCGGCCACAGAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025701.4-636s21c1
Sequence:CCGGGGACCACACTCATGATCAAATCTCGAGATTTGATCATGAGTGTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000248050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025701.4-471s21c1
Sequence:CCGGCCCGCACTTTCTACATCATCGCTCGAGCGATGATGTAGAAAGTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025701
VALIDATED
TRAPPC5 MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 5
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201674    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025701.2-1012s1c1
Sequence:CCGGGCCGTGGGTTTGATTCCTTATCTCGAGATAAGGAATCAAACCCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025701.2-495s1c1
Sequence:CCGGCAAGGAGAACAGCACACTGAACTCGAGTTCAGTGTGCTGTTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025701.2-465s1c1
Sequence:CCGGGCCGCTCATTAACACCTACATCTCGAGATGTAGGTGTTAATGAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025701.4-499s21c1
Sequence:CCGGGCCGCTCATTAACACCTACATCTCGAGATGTAGGTGTTAATGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025701.4-1068s21c1
Sequence:CCGGCCACATAAAGTGGGTACAAATCTCGAGATTTGTACCCACTTTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025701.4-268s21c1
Sequence:CCGGTTTCTCTGTGGCCGAGCTTCACTCGAGTGAAGCTCGGCCACAGAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025701.4-636s21c1
Sequence:CCGGGGACCACACTCATGATCAAATCTCGAGATTTGATCATGAGTGTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000248050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025701.4-471s21c1
Sequence:CCGGCCCGCACTTTCTACATCATCGCTCGAGCGATGATGTAGAAAGTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025701
VALIDATED
TRAPPC5 MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 5
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201674    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025701.2-1012s1c1
Sequence:CCGGGCCGTGGGTTTGATTCCTTATCTCGAGATAAGGAATCAAACCCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190892    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025701.2-495s1c1
Sequence:CCGGCAAGGAGAACAGCACACTGAACTCGAGTTCAGTGTGCTGTTCTCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190790    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025701.2-465s1c1
Sequence:CCGGGCCGCTCATTAACACCTACATCTCGAGATGTAGGTGTTAATGAGCGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248052    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025701.4-499s21c1
Sequence:CCGGGCCGCTCATTAACACCTACATCTCGAGATGTAGGTGTTAATGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248053    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025701.4-1068s21c1
Sequence:CCGGCCACATAAAGTGGGTACAAATCTCGAGATTTGTACCCACTTTATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248054    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.71 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025701.4-268s21c1
Sequence:CCGGTTTCTCTGTGGCCGAGCTTCACTCGAGTGAAGCTCGGCCACAGAGAAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248051    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025701.4-636s21c1
Sequence:CCGGGGACCACACTCATGATCAAATCTCGAGATTTGATCATGAGTGTGGTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000248050    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025701.4-471s21c1
Sequence:CCGGCCCGCACTTTCTACATCATCGCTCGAGCGATGATGTAGAAAGTGCGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001042461
VALIDATED
TRAPPC5 MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 5
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000257461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042461.1-558s21c1
Sequence:CCGGGAGAACAGCACGCTCAACTGCCTCGAGGCAGTTGAGCGTGCTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042461.1-410s21c1
Sequence:CCGGAGGCGCGTTGCTCTTCGTCAACTCGAGTTGACGAAGAGCAACGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042461.1-257s21c1
Sequence:CCGGGTTCTCCGAGCTGGTACAGCACTCGAGTGCTGTACCAGCTCGGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042461.1-524s21c1
Sequence:CCGGGCCGCTCATCAACACCTACATCTCGAGATGTAGGTGTTGATGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000245667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042461.1-497s21c1
Sequence:CCGGGCGCACCTTCTACATCATCGACTCGAGTCGATGATGTAGAAGGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001042461
VALIDATED
TRAPPC5 MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 5
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000257461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042461.1-558s21c1
Sequence:CCGGGAGAACAGCACGCTCAACTGCCTCGAGGCAGTTGAGCGTGCTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042461.1-410s21c1
Sequence:CCGGAGGCGCGTTGCTCTTCGTCAACTCGAGTTGACGAAGAGCAACGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042461.1-257s21c1
Sequence:CCGGGTTCTCCGAGCTGGTACAGCACTCGAGTGCTGTACCAGCTCGGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042461.1-524s21c1
Sequence:CCGGGCCGCTCATCAACACCTACATCTCGAGATGTAGGTGTTGATGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000245667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042461.1-497s21c1
Sequence:CCGGGCGCACCTTCTACATCATCGACTCGAGTCGATGATGTAGAAGGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001042461
VALIDATED
TRAPPC5 MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 5
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000257461    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042461.1-558s21c1
Sequence:CCGGGAGAACAGCACGCTCAACTGCCTCGAGGCAGTTGAGCGTGCTGTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245666    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042461.1-410s21c1
Sequence:CCGGAGGCGCGTTGCTCTTCGTCAACTCGAGTTGACGAAGAGCAACGCGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245669    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042461.1-257s21c1
Sequence:CCGGGTTCTCCGAGCTGGTACAGCACTCGAGTGCTGTACCAGCTCGGAGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245668    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042461.1-524s21c1
Sequence:CCGGGCCGCTCATCAACACCTACATCTCGAGATGTAGGTGTTGATGAGCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000245667    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.85 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_001042461.1-497s21c1
Sequence:CCGGGCGCACCTTCTACATCATCGACTCGAGTCGATGATGTAGAAGGTGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks