EMAIL THIS PAGE TO A FRIEND

TRAPPC6A

trafficking protein particle complex 6A

Synonyms: TRS33
UniProtKB ID: O75865, K7ERB1, K7ERQ4, Q9BQ45, Q9P092
Gene ID:
Human(79090) Summary: This gene encodes a component of the trafficking protein particle complex, which tethers transport vesicles to the cis-Golgi membrane. Loss of expression of the related gene in mouse affects coat and eye pigmentation, suggesting that the encoded protein may be involved in melanosome biogenesis. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Aug 2012]
Mouse(67091) trafficking protein particle complex 6A
Rat(680465) trafficking protein particle complex 6A
dog(612313) trafficking protein particle complex 6A
domestic cat(101096189) trafficking protein particle complex 6A
naked mole-rat(101722331) trafficking protein particle complex 6A
domestic guinea pig(100720496) trafficking protein particle complex 6A
cow(512261) trafficking protein particle complex 6A
sheep(101114550) trafficking protein particle complex 6A
49 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024108 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024108 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024108 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025960 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025960 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025960 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024108 Rosetta Predictions human pricing
NM_001109410 Rosetta Predictions rat pricing
NM_025960 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024108 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00029308 predicted 238
2 SASI_Hs01_00029309 predicted 323
3 SASI_Hs01_00029310 predicted 394
4 SASI_Hs01_00029311 predicted 478
5 SASI_Hs02_00356599 predicted 509
6 SASI_Hs01_00029313 predicted 453
7 SASI_Hs01_00029314 predicted 240
8 SASI_Hs01_00029315 predicted 289
9 SASI_Hs01_00029317 predicted 423
10 SASI_Hs02_00356600 predicted 235
11 SASI_Hs01_00029312 predicted 278
12 SASI_Hs01_00029316 predicted 573
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001109410 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00248137 predicted 458
2 SASI_Rn02_00248138 predicted 301
3 SASI_Rn02_00248139 predicted 207
4 SASI_Rn02_00248140 predicted 404
5 SASI_Rn02_00248141 predicted 469
6 SASI_Rn02_00248142 predicted 198
7 SASI_Rn02_00248143 predicted 411
8 SASI_Rn02_00248144 predicted 513
9 SASI_Rn02_00248145 predicted 245
10 SASI_Rn02_00248146 predicted 204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00133763 predicted 537
2 SASI_Mm01_00133764 predicted 289
3 SASI_Mm01_00133765 predicted 372
4 SASI_Mm01_00133767 predicted 198
5 SASI_Mm01_00133768 predicted 525
6 SASI_Mm02_00329361 predicted 393
7 SASI_Mm01_00133770 predicted 211
8 SASI_Mm01_00133772 predicted 476
9 SASI_Mm02_00329362 predicted 405
10 SASI_Mm02_00329363 predicted 207
11 SASI_Mm01_00133766 predicted 230
12 SASI_Mm01_00133769 predicted 228
13 SASI_Mm01_00133771 predicted 239
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024108
TRAPPC6A MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 6A
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000444496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024108.1-445s21c1
Sequence:CCGGTATACCCTGGGCATTGAGAGCCTCGAGGCTCTCAATGCCCAGGGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024108.1-35s21c1
Sequence:CCGGTTCTTCACACGGAGATGGTGGCTCGAGCCACCATCTCCGTGTGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024108.1-496s21c1
Sequence:CCGGGTCTGTAAGTTCCAGGTGGTGCTCGAGCACCACCTGGAACTTACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024108.1-252s1c1
Sequence:CCGGGTTCTTGTGCAAAGACCTGTGCTCGAGCACAGGTCTTTGCACAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024108.1-237s1c1
Sequence:CCGGGCTGGATGTCCTCAAGTTCTTCTCGAGAAGAACTTGAGGACATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180510    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024108.1-650s1c1
Sequence:CCGGGCTCAGGAAGTGGGTATCAAACTCGAGTTTGATACCCACTTCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000179048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024108.1-651s1c1
Sequence:CCGGCTCAGGAAGTGGGTATCAAATCTCGAGATTTGATACCCACTTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024108
TRAPPC6A MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 6A
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000444496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024108.1-445s21c1
Sequence:CCGGTATACCCTGGGCATTGAGAGCCTCGAGGCTCTCAATGCCCAGGGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024108.1-35s21c1
Sequence:CCGGTTCTTCACACGGAGATGGTGGCTCGAGCCACCATCTCCGTGTGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024108.1-496s21c1
Sequence:CCGGGTCTGTAAGTTCCAGGTGGTGCTCGAGCACCACCTGGAACTTACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024108.1-252s1c1
Sequence:CCGGGTTCTTGTGCAAAGACCTGTGCTCGAGCACAGGTCTTTGCACAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024108.1-237s1c1
Sequence:CCGGGCTGGATGTCCTCAAGTTCTTCTCGAGAAGAACTTGAGGACATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180510    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024108.1-650s1c1
Sequence:CCGGGCTCAGGAAGTGGGTATCAAACTCGAGTTTGATACCCACTTCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000179048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024108.1-651s1c1
Sequence:CCGGCTCAGGAAGTGGGTATCAAATCTCGAGATTTGATACCCACTTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024108
TRAPPC6A MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 6A
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000444496    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024108.1-445s21c1
Sequence:CCGGTATACCCTGGGCATTGAGAGCCTCGAGGCTCTCAATGCCCAGGGTATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437499    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024108.1-35s21c1
Sequence:CCGGTTCTTCACACGGAGATGGTGGCTCGAGCCACCATCTCCGTGTGAAGAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437628    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024108.1-496s21c1
Sequence:CCGGGTCTGTAAGTTCCAGGTGGTGCTCGAGCACCACCTGGAACTTACAGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180596    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024108.1-252s1c1
Sequence:CCGGGTTCTTGTGCAAAGACCTGTGCTCGAGCACAGGTCTTTGCACAAGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180414    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_024108.1-237s1c1
Sequence:CCGGGCTGGATGTCCTCAAGTTCTTCTCGAGAAGAACTTGAGGACATCCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180510    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024108.1-650s1c1
Sequence:CCGGGCTCAGGAAGTGGGTATCAAACTCGAGTTTGATACCCACTTCCTGAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000179048    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_024108.1-651s1c1
Sequence:CCGGCTCAGGAAGTGGGTATCAAATCTCGAGATTTGATACCCACTTCCTGAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025960
VALIDATED
TRAPPC6A MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 6A
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000249560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025960.3-192s21c1
Sequence:CCGGGCCTTTAGGGAGGAGTTAGATCTCGAGATCTAACTCCTCCCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025960.3-473s21c1
Sequence:CCGGGTTCCAGGTGGTGATCCAGAACTCGAGTTCTGGATCACCACCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025960.3-528s21c1
Sequence:CCGGCCTAAGCTTAGCCTCGGAATGCTCGAGCATTCCGAGGCTAAGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000249557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025960.3-218s21c1
Sequence:CCGGCAAGTTCCTGTGCAGAGATCTCTCGAGAGATCTCTGCACAGGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000257936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025960.3-295s21c1
Sequence:CCGGCCTATGTGCTGCAGGACAACACTCGAGTGTTGTCCTGCAGCACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195800    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025960.2-662s1c1
Sequence:CCGGCATGTGCTTCAGACAAGGGAACTCGAGTTCCCTTGTCTGAAGCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025960.2-241s1c1
Sequence:CCGGGAGTTAGATGCCCTCAAGTTCCTCGAGGAACTTGAGGGCATCTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025960.2-243s1c1
Sequence:CCGGGTTAGATGCCCTCAAGTTCCTCTCGAGAGGAACTTGAGGGCATCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025960
VALIDATED
TRAPPC6A MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 6A
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000249560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025960.3-192s21c1
Sequence:CCGGGCCTTTAGGGAGGAGTTAGATCTCGAGATCTAACTCCTCCCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025960.3-473s21c1
Sequence:CCGGGTTCCAGGTGGTGATCCAGAACTCGAGTTCTGGATCACCACCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025960.3-528s21c1
Sequence:CCGGCCTAAGCTTAGCCTCGGAATGCTCGAGCATTCCGAGGCTAAGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000249557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025960.3-218s21c1
Sequence:CCGGCAAGTTCCTGTGCAGAGATCTCTCGAGAGATCTCTGCACAGGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000257936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025960.3-295s21c1
Sequence:CCGGCCTATGTGCTGCAGGACAACACTCGAGTGTTGTCCTGCAGCACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195800    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025960.2-662s1c1
Sequence:CCGGCATGTGCTTCAGACAAGGGAACTCGAGTTCCCTTGTCTGAAGCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025960.2-241s1c1
Sequence:CCGGGAGTTAGATGCCCTCAAGTTCCTCGAGGAACTTGAGGGCATCTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025960.2-243s1c1
Sequence:CCGGGTTAGATGCCCTCAAGTTCCTCTCGAGAGGAACTTGAGGGCATCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025960
VALIDATED
TRAPPC6A MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 6A
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000249560    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.84 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025960.3-192s21c1
Sequence:CCGGGCCTTTAGGGAGGAGTTAGATCTCGAGATCTAACTCCTCCCTAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249559    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025960.3-473s21c1
Sequence:CCGGGTTCCAGGTGGTGATCCAGAACTCGAGTTCTGGATCACCACCTGGAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249558    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025960.3-528s21c1
Sequence:CCGGCCTAAGCTTAGCCTCGGAATGCTCGAGCATTCCGAGGCTAAGCTTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000249557    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025960.3-218s21c1
Sequence:CCGGCAAGTTCCTGTGCAGAGATCTCTCGAGAGATCTCTGCACAGGAACTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000257936    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: B16-F0
TRC Version: 2 Clone ID:NM_025960.3-295s21c1
Sequence:CCGGCCTATGTGCTGCAGGACAACACTCGAGTGTTGTCCTGCAGCACATAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195800    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025960.2-662s1c1
Sequence:CCGGCATGTGCTTCAGACAAGGGAACTCGAGTTCCCTTGTCTGAAGCACATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184476    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025960.2-241s1c1
Sequence:CCGGGAGTTAGATGCCCTCAAGTTCCTCGAGGAACTTGAGGGCATCTAACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184349    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025960.2-243s1c1
Sequence:CCGGGTTAGATGCCCTCAAGTTCCTCTCGAGAGGAACTTGAGGGCATCTAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks