EMAIL THIS PAGE TO A FRIEND

TRAPPC6B

trafficking protein particle complex 6B

Synonyms: TPC6
UniProtKB ID: Q86SZ2, B3KPS2, Q5JPD6, Q86U35, Q86X35
Gene ID:
Human(122553) Summary: TRAPPC6B is a component of TRAPP complexes, which are tethering complexes involved in vesicle transport (Kummel et al., 2005 [PubMed 16025134]
Mouse(78232) trafficking protein particle complex 6B
Rat(299075) trafficking protein particle complex 6B
cow(521470) trafficking protein particle complex 6B
sheep(101123500) trafficking protein particle complex 6B
domestic guinea pig(100712931) trafficking protein particle complex 6B
naked mole-rat(101716339) trafficking protein particle complex 6B
Zebrafish(450008) trafficking protein particle complex 6b
domestic cat(101086981) trafficking protein particle complex 6B
dog(480296) trafficking protein particle complex 6B
chicken(423337) trafficking protein particle complex 6B
79 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
AV53348 Anti-TRAPPC6B antibody produced in rabbit affinity isolated antibody , rabbit, canine, mouse, rat, guinea pig, zebrafish, human, horse, bovine
western blot pricing
HPA047928 Anti-TRAPPC6B antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_030057 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_030057 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_030057 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_177452 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_177452 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_177452 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001079537 Rosetta Predictions human pricing
NM_177452 Rosetta Predictions human pricing
NM_001106733 Rosetta Predictions rat pricing
NM_030057 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001079537 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00313570 predicted 964
2 SASI_Hs02_00313571 predicted 900
3 SASI_Hs02_00313572 predicted 890
4 SASI_Hs02_00313573 predicted 928
5 SASI_Hs02_00313574 predicted 528
6 SASI_Hs02_00313575 predicted 516
7 SASI_Hs02_00313576 predicted 559
8 SASI_Hs02_00313577 predicted 671
9 SASI_Hs02_00313578 predicted 579
10 SASI_Hs02_00313579 predicted 720
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_177452 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00369344 predicted 873
2 SASI_Hs01_00065512 predicted 815
3 SASI_Hs01_00065514 predicted 806
4 SASI_Hs02_00369345 predicted 848
5 SASI_Hs01_00065510 predicted 529
6 SASI_Hs01_00065511 predicted 520
7 SASI_Hs01_00065513 predicted 560
8 SASI_Hs01_00065515 predicted 629
9 SASI_Hs01_00065516 predicted 464
10 SASI_Hs01_00065517 predicted 753
11 SASI_Hs01_00065518 predicted 510
12 SASI_Hs01_00065519 predicted 487
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106733 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00221858 predicted 363
2 SASI_Rn02_00221859 predicted 520
3 SASI_Rn02_00221860 predicted 309
4 SASI_Rn02_00221861 predicted 425
5 SASI_Rn02_00221862 predicted 438
6 SASI_Rn02_00221863 predicted 616
7 SASI_Rn02_00221864 predicted 342
8 SASI_Rn02_00221865 predicted 416
9 SASI_Rn02_00221866 predicted 670
10 SASI_Rn02_00221867 predicted 462
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_030057 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00073962 predicted 592
2 SASI_Mm01_00073963 predicted 373
3 SASI_Mm01_00073964 predicted 376
4 SASI_Mm02_00336420 predicted 484
5 SASI_Mm01_00073965 predicted 582
6 SASI_Mm01_00073966 predicted 610
7 SASI_Mm02_00336421 predicted 529
8 SASI_Mm01_00073968 predicted 571
9 SASI_Mm02_00336422 predicted 514
10 SASI_Mm01_00073969 predicted 576
11 SASI_Mm01_00073967 predicted 468
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_030057
VALIDATED
TRAPPC6B MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 6B
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030057.1-350s1c1
Sequence:CCGGGATACTGCAAGGTTCAAGGATCTCGAGATCCTTGAACCTTGCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000200933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030057.1-473s1c1
Sequence:CCGGCAGGACAACAAATTTCGACTACTCGAGTAGTCGAAATTTGTTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030057.1-887s1c1
Sequence:CCGGCCATAGGTGATTAGCATTTAACTCGAGTTAAATGCTAATCACCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030057.1-364s1c1
Sequence:CCGGCAAGGATGAATTAGACATCATCTCGAGATGATGTCTAATTCATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030057.1-964s1c1
Sequence:CCGGCCAATCAGAATAGTTTGTGTTCTCGAGAACACAAACTATTCTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_030057
VALIDATED
TRAPPC6B MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 6B
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030057.1-350s1c1
Sequence:CCGGGATACTGCAAGGTTCAAGGATCTCGAGATCCTTGAACCTTGCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000200933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030057.1-473s1c1
Sequence:CCGGCAGGACAACAAATTTCGACTACTCGAGTAGTCGAAATTTGTTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030057.1-887s1c1
Sequence:CCGGCCATAGGTGATTAGCATTTAACTCGAGTTAAATGCTAATCACCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030057.1-364s1c1
Sequence:CCGGCAAGGATGAATTAGACATCATCTCGAGATGATGTCTAATTCATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030057.1-964s1c1
Sequence:CCGGCCAATCAGAATAGTTTGTGTTCTCGAGAACACAAACTATTCTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_030057
VALIDATED
TRAPPC6B MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 6B
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201704    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030057.1-350s1c1
Sequence:CCGGGATACTGCAAGGTTCAAGGATCTCGAGATCCTTGAACCTTGCAGTATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000200933    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030057.1-473s1c1
Sequence:CCGGCAGGACAACAAATTTCGACTACTCGAGTAGTCGAAATTTGTTGTCCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192016    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.91 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030057.1-887s1c1
Sequence:CCGGCCATAGGTGATTAGCATTTAACTCGAGTTAAATGCTAATCACCTATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191438    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030057.1-364s1c1
Sequence:CCGGCAAGGATGAATTAGACATCATCTCGAGATGATGTCTAATTCATCCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192017    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.85 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_030057.1-964s1c1
Sequence:CCGGCCAATCAGAATAGTTTGTGTTCTCGAGAACACAAACTATTCTGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_177452
TRAPPC6B MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 6B
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000149211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177452.2-518s1c1
Sequence:CCGGGTGGCTTATCAAACTTGGGAACTCGAGTTCCCAAGTTTGATAAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177452.2-2604s1c1
Sequence:CCGGCCAATCATGGTAATTGGCTTACTCGAGTAAGCCAATTACCATGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177452.2-310s1c1
Sequence:CCGGCGATGTATTACTAAGCTGGAACTCGAGTTCCAGCTTAGTAATACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177452.2-1696s1c1
Sequence:CCGGGCCATAGAAATGGCAGATTAACTCGAGTTAATCTGCCATTTCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177452.2-385s1c1
Sequence:CCGGGCAAGGTTCAAGGATGAGTTACTCGAGTAACTCATCCTTGAACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000130744    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177452.2-626s1c1
Sequence:CCGGGCAAGGCTTCAACAGTGTAAACTCGAGTTTACACTGTTGAAGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177452.2-462s1c1
Sequence:CCGGCGACAATCTAAGGACAAATCACTCGAGTGATTTGTCCTTAGATTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000129841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177452.2-457s1c1
Sequence:CCGGCAAATCGACAATCTAAGGACACTCGAGTGTCCTTAGATTGTCGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177452.3-609s21c1
Sequence:CCGGGCATTTACGTGTGGCTTAATCCTCGAGGATTAAGCCACACGTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000433572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177452.3-954s21c1
Sequence:CCGGCAAGATGCAGGGCCCTTATTTCTCGAGAAATAAGGGCCCTGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177452.3-638s21c1
Sequence:CCGGCTTATCAAACTTGGGAATAAACTCGAGTTTATTCCCAAGTTTGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177452.3-852s21c1
Sequence:CCGGTCAATTTAACACAGATCAAAGCTCGAGCTTTGATCTGTGTTAAATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177452.3-751s21c1
Sequence:CCGGCAACAGTGTAAAGAGATAAATCTCGAGATTTATCTCTTTACACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_177452
TRAPPC6B MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 6B
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000149211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177452.2-518s1c1
Sequence:CCGGGTGGCTTATCAAACTTGGGAACTCGAGTTCCCAAGTTTGATAAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177452.2-2604s1c1
Sequence:CCGGCCAATCATGGTAATTGGCTTACTCGAGTAAGCCAATTACCATGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177452.2-310s1c1
Sequence:CCGGCGATGTATTACTAAGCTGGAACTCGAGTTCCAGCTTAGTAATACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177452.2-1696s1c1
Sequence:CCGGGCCATAGAAATGGCAGATTAACTCGAGTTAATCTGCCATTTCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177452.2-385s1c1
Sequence:CCGGGCAAGGTTCAAGGATGAGTTACTCGAGTAACTCATCCTTGAACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000130744    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177452.2-626s1c1
Sequence:CCGGGCAAGGCTTCAACAGTGTAAACTCGAGTTTACACTGTTGAAGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177452.2-462s1c1
Sequence:CCGGCGACAATCTAAGGACAAATCACTCGAGTGATTTGTCCTTAGATTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000129841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177452.2-457s1c1
Sequence:CCGGCAAATCGACAATCTAAGGACACTCGAGTGTCCTTAGATTGTCGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177452.3-609s21c1
Sequence:CCGGGCATTTACGTGTGGCTTAATCCTCGAGGATTAAGCCACACGTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000433572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177452.3-954s21c1
Sequence:CCGGCAAGATGCAGGGCCCTTATTTCTCGAGAAATAAGGGCCCTGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177452.3-638s21c1
Sequence:CCGGCTTATCAAACTTGGGAATAAACTCGAGTTTATTCCCAAGTTTGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177452.3-852s21c1
Sequence:CCGGTCAATTTAACACAGATCAAAGCTCGAGCTTTGATCTGTGTTAAATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177452.3-751s21c1
Sequence:CCGGCAACAGTGTAAAGAGATAAATCTCGAGATTTATCTCTTTACACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_177452
TRAPPC6B MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 6B
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000149211    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177452.2-518s1c1
Sequence:CCGGGTGGCTTATCAAACTTGGGAACTCGAGTTCCCAAGTTTGATAAGCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146801    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177452.2-2604s1c1
Sequence:CCGGCCAATCATGGTAATTGGCTTACTCGAGTAAGCCAATTACCATGATTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146857    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177452.2-310s1c1
Sequence:CCGGCGATGTATTACTAAGCTGGAACTCGAGTTCCAGCTTAGTAATACATCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147975    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_177452.2-1696s1c1
Sequence:CCGGGCCATAGAAATGGCAGATTAACTCGAGTTAATCTGCCATTTCTATGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130908    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177452.2-385s1c1
Sequence:CCGGGCAAGGTTCAAGGATGAGTTACTCGAGTAACTCATCCTTGAACCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000130744    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_177452.2-626s1c1
Sequence:CCGGGCAAGGCTTCAACAGTGTAAACTCGAGTTTACACTGTTGAAGCCTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129851    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_177452.2-462s1c1
Sequence:CCGGCGACAATCTAAGGACAAATCACTCGAGTGATTTGTCCTTAGATTGTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000129841    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_177452.2-457s1c1
Sequence:CCGGCAAATCGACAATCTAAGGACACTCGAGTGTCCTTAGATTGTCGATTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435222    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177452.3-609s21c1
Sequence:CCGGGCATTTACGTGTGGCTTAATCCTCGAGGATTAAGCCACACGTAAATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000433572    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177452.3-954s21c1
Sequence:CCGGCAAGATGCAGGGCCCTTATTTCTCGAGAAATAAGGGCCCTGCATCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435173    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_177452.3-638s21c1
Sequence:CCGGCTTATCAAACTTGGGAATAAACTCGAGTTTATTCCCAAGTTTGATAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423274    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177452.3-852s21c1
Sequence:CCGGTCAATTTAACACAGATCAAAGCTCGAGCTTTGATCTGTGTTAAATTGATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_177452.3-751s21c1
Sequence:CCGGCAACAGTGTAAAGAGATAAATCTCGAGATTTATCTCTTTACACTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks