EMAIL THIS PAGE TO A FRIEND

TRAPPC8

trafficking protein particle complex 8

Synonyms: GSG1 HsT2706 KIAA1012 TRS85
UniProtKB ID: Q9Y2L5, A0JP15, B3KME5, Q9H0L2
Gene ID:
Mouse(75964) trafficking protein particle complex 8
Rat(291750) trafficking protein particle complex 8
Zebrafish(570167) trafficking protein particle complex 8
Horse(100052273) trafficking protein particle complex 8
chicken(421095) trafficking protein particle complex 8
domestic cat(101088623) trafficking protein particle complex 8
dog(480166) trafficking protein particle complex 8
naked mole-rat(101724335) trafficking protein particle complex 8
domestic guinea pig(100734836) trafficking protein particle complex 8
cow(538805) trafficking protein particle complex 8
sheep(101114576) trafficking protein particle complex 8
103 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
HPA041107 Anti-TRAPPC8 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014939 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014939 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014939 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029491 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029491 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029491 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014939 Rosetta Predictions human pricing
NM_001106160 Rosetta Predictions rat pricing
NM_029491 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014939 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00346610 predicted 1865
2 SASI_Hs02_00346611 predicted 2770
3 SASI_Hs01_00168619 predicted 3461
4 SASI_Hs02_00346612 predicted 1953
5 SASI_Hs01_00168621 predicted 801
6 SASI_Hs01_00168622 predicted 1960
7 SASI_Hs02_00346613 predicted 1241
8 SASI_Hs01_00168623 predicted 1799
9 SASI_Hs01_00168625 predicted 4403
10 SASI_Hs01_00168627 predicted 1141
11 SASI_Hs01_00168620 predicted 3161
12 SASI_Hs01_00168624 predicted 1920
13 SASI_Hs01_00168626 predicted 1516
14 SASI_Hs01_00168628 predicted 3687
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106160 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00216218 predicted 1115
2 SASI_Rn02_00216219 predicted 828
3 SASI_Rn02_00216220 predicted 813
4 SASI_Rn02_00216221 predicted 1127
5 SASI_Rn02_00216222 predicted 3227
6 SASI_Rn02_00216223 predicted 1526
7 SASI_Rn02_00216224 predicted 3484
8 SASI_Rn02_00216225 predicted 2952
9 SASI_Rn02_00216226 predicted 3449
10 SASI_Rn02_00216227 predicted 2856
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029491 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00135703 predicted 426
2 SASI_Mm01_00135704 predicted 809
3 SASI_Mm01_00135705 predicted 2214
4 SASI_Mm01_00135706 predicted 2174
5 SASI_Mm01_00135707 predicted 802
6 SASI_Mm01_00135708 predicted 1114
7 SASI_Mm01_00135709 predicted 341
8 SASI_Mm02_00335419 predicted 894
9 SASI_Mm01_00135710 predicted 2089
10 SASI_Mm01_00135711 predicted 1516
11 SASI_Mm01_00135712 predicted 858
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014939
VALIDATED
TRAPPC8 MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 8
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000330712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014939.3-3064s21c1
Sequence:CCGGTCGACGTTTAGATCCCATAATCTCGAGATTATGGGATCTAAACGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014939.3-4409s21c1
Sequence:CCGGATAGTTGATCTTCGGCATAAACTCGAGTTTATGCCGAAGATCAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014939.3-2354s21c1
Sequence:CCGGCAGCTTCCTTTACCGTATATTCTCGAGAATATACGGTAAAGGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014939.3-4980s21c1
Sequence:CCGGGTCAATGGTATACGAATATTACTCGAGTAATATTCGTATACCATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000330714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014939.3-2058s21c1
Sequence:CCGGTATTGGCAGGCCATCGATTTACTCGAGTAAATCGATGGCCTGCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014939.2-1131s1c1
Sequence:CCGGCCCTTGTACTATAACTTCAAACTCGAGTTTGAAGTTATAGTACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014939.2-2743s1c1
Sequence:CCGGCCTGAAATGATTGGAGCTGAACTCGAGTTCAGCTCCAATCATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014939.2-1597s1c1
Sequence:CCGGCCAGAACTTCAAATCAGGAAACTCGAGTTTCCTGATTTGAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014939.2-514s1c1
Sequence:CCGGCCTAATAATCAACTTCACGTACTCGAGTACGTGAAGTTGATTATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000059946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014939.2-4372s1c1
Sequence:CCGGGCTGATGTAGATGTCATAGTTCTCGAGAACTATGACATCTACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014939
VALIDATED
TRAPPC8 MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 8
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000330712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014939.3-3064s21c1
Sequence:CCGGTCGACGTTTAGATCCCATAATCTCGAGATTATGGGATCTAAACGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014939.3-4409s21c1
Sequence:CCGGATAGTTGATCTTCGGCATAAACTCGAGTTTATGCCGAAGATCAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014939.3-2354s21c1
Sequence:CCGGCAGCTTCCTTTACCGTATATTCTCGAGAATATACGGTAAAGGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014939.3-4980s21c1
Sequence:CCGGGTCAATGGTATACGAATATTACTCGAGTAATATTCGTATACCATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000330714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014939.3-2058s21c1
Sequence:CCGGTATTGGCAGGCCATCGATTTACTCGAGTAAATCGATGGCCTGCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014939.2-1131s1c1
Sequence:CCGGCCCTTGTACTATAACTTCAAACTCGAGTTTGAAGTTATAGTACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014939.2-2743s1c1
Sequence:CCGGCCTGAAATGATTGGAGCTGAACTCGAGTTCAGCTCCAATCATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014939.2-1597s1c1
Sequence:CCGGCCAGAACTTCAAATCAGGAAACTCGAGTTTCCTGATTTGAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014939.2-514s1c1
Sequence:CCGGCCTAATAATCAACTTCACGTACTCGAGTACGTGAAGTTGATTATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000059946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014939.2-4372s1c1
Sequence:CCGGGCTGATGTAGATGTCATAGTTCTCGAGAACTATGACATCTACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014939
VALIDATED
TRAPPC8 MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 8
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000330712    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014939.3-3064s21c1
Sequence:CCGGTCGACGTTTAGATCCCATAATCTCGAGATTATGGGATCTAAACGTCGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014939.3-4409s21c1
Sequence:CCGGATAGTTGATCTTCGGCATAAACTCGAGTTTATGCCGAAGATCAACTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330713    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014939.3-2354s21c1
Sequence:CCGGCAGCTTCCTTTACCGTATATTCTCGAGAATATACGGTAAAGGAAGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330715    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 293T/17
TRC Version: 2 Clone ID:NM_014939.3-4980s21c1
Sequence:CCGGGTCAATGGTATACGAATATTACTCGAGTAATATTCGTATACCATTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000330714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014939.3-2058s21c1
Sequence:CCGGTATTGGCAGGCCATCGATTTACTCGAGTAAATCGATGGCCTGCCAATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059943    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_014939.2-1131s1c1
Sequence:CCGGCCCTTGTACTATAACTTCAAACTCGAGTTTGAAGTTATAGTACAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014939.2-2743s1c1
Sequence:CCGGCCTGAAATGATTGGAGCTGAACTCGAGTTCAGCTCCAATCATTTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014939.2-1597s1c1
Sequence:CCGGCCAGAACTTCAAATCAGGAAACTCGAGTTTCCTGATTTGAAGTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014939.2-514s1c1
Sequence:CCGGCCTAATAATCAACTTCACGTACTCGAGTACGTGAAGTTGATTATTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000059946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_014939.2-4372s1c1
Sequence:CCGGGCTGATGTAGATGTCATAGTTCTCGAGAACTATGACATCTACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029491
VALIDATED
TRAPPC8 MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 8
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029491.1-1056s1c1
Sequence:CCGGCGACAGTTTATACAAGAGTTTCTCGAGAAACTCTTGTATAAACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029491.1-2168s1c1
Sequence:CCGGTGTGGCTAATAAAGGAGTAATCTCGAGATTACTCCTTTATTAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029491.1-2256s1c1
Sequence:CCGGGCAGTTGTAGAAGAGCCAATTCTCGAGAATTGGCTCTTCTACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029491.1-2482s1c1
Sequence:CCGGCTGTGCTTATTCTTGAAATGTCTCGAGACATTTCAAGAATAAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029491.1-2397s1c1
Sequence:CCGGCGAGTAAGTTATTGCAGGTATCTCGAGATACCTGCAATAACTTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029491
VALIDATED
TRAPPC8 MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 8
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029491.1-1056s1c1
Sequence:CCGGCGACAGTTTATACAAGAGTTTCTCGAGAAACTCTTGTATAAACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029491.1-2168s1c1
Sequence:CCGGTGTGGCTAATAAAGGAGTAATCTCGAGATTACTCCTTTATTAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029491.1-2256s1c1
Sequence:CCGGGCAGTTGTAGAAGAGCCAATTCTCGAGAATTGGCTCTTCTACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029491.1-2482s1c1
Sequence:CCGGCTGTGCTTATTCTTGAAATGTCTCGAGACATTTCAAGAATAAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029491.1-2397s1c1
Sequence:CCGGCGAGTAAGTTATTGCAGGTATCTCGAGATACCTGCAATAACTTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029491
VALIDATED
TRAPPC8 MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 8
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100912    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029491.1-1056s1c1
Sequence:CCGGCGACAGTTTATACAAGAGTTTCTCGAGAAACTCTTGTATAAACTGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100914    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029491.1-2168s1c1
Sequence:CCGGTGTGGCTAATAAAGGAGTAATCTCGAGATTACTCCTTTATTAGCCACATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100913    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_029491.1-2256s1c1
Sequence:CCGGGCAGTTGTAGAAGAGCCAATTCTCGAGAATTGGCTCTTCTACAACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100910    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_029491.1-2482s1c1
Sequence:CCGGCTGTGCTTATTCTTGAAATGTCTCGAGACATTTCAAGAATAAGCACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100911    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029491.1-2397s1c1
Sequence:CCGGCGAGTAAGTTATTGCAGGTATCTCGAGATACCTGCAATAACTTACTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks