EMAIL THIS PAGE TO A FRIEND

TRAPPC9

trafficking protein particle complex 9

Synonyms: IBP IKBKBBP MRT13 NIBP TRS120
Gene ID:
Human(83696) Summary: This gene encodes a protein that likely plays a role in NF-kappa-B signaling. Mutations in this gene have been associated with autosomal-recessive mental retardation. Alternatively spliced transcript variants have been described.[provided by RefSeq, Feb 2010]
Mouse(76510) trafficking protein particle complex 9
Rat(315059) trafficking protein particle complex 9
cow(533451) trafficking protein particle complex 9
sheep(101121686) trafficking protein particle complex 9
domestic guinea pig(100726216) trafficking protein particle complex 9
naked mole-rat(101715292) trafficking protein particle complex 9
Domestic Rabbit(100338132) trafficking protein particle complex 9
Zebrafish(100334971) trafficking protein particle complex 9
chicken(420312) trafficking protein particle complex 9
Horse(100069518) trafficking protein particle complex 9
domestic cat(101095401) trafficking protein particle complex 9
dog(482058) trafficking protein particle complex 9
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_029640 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029640 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029640 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_031466 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_031466 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_031466 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_031466 Rosetta Predictions human pricing
XM_001068491 Rosetta Predictions rat pricing
XM_235402 Rosetta Predictions rat pricing
NM_029640 Rosetta Predictions mouse pricing
NM_180662 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031466 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00120692 predicted 2106
2 SASI_Hs01_00120693 predicted 2495
3 SASI_Hs01_00120694 predicted 1327
4 SASI_Hs01_00120695 predicted 2673
5 SASI_Hs01_00120696 predicted 632
6 SASI_Hs01_00120697 predicted 1303
7 SASI_Hs01_00120698 predicted 1208
8 SASI_Hs01_00120699 predicted 2696
9 SASI_Hs01_00120700 predicted 1349
10 SASI_Hs01_00120701 predicted 2563
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001068491 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00324685 predicted 1242
2 SASI_Rn02_00324686 predicted 2197
3 SASI_Rn02_00324687 predicted 2396
4 SASI_Rn02_00324688 predicted 3788
5 SASI_Rn02_00324689 predicted 1268
6 SASI_Rn02_00324690 predicted 2439
7 SASI_Rn02_00324691 predicted 3461
8 SASI_Rn02_00324692 predicted 1436
9 SASI_Rn02_00324693 predicted 789
10 SASI_Rn02_00324694 predicted 2851
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_235402 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00389268 predicted 1271
2 SASI_Rn02_00389269 predicted 3816
3 SASI_Rn02_00389270 predicted 1298
4 SASI_Rn02_00389271 predicted 3484
5 SASI_Rn02_00389272 predicted 1463
6 SASI_Rn02_00389273 predicted 1088
7 SASI_Rn02_00389274 predicted 2693
8 SASI_Rn02_00389275 predicted 786
9 SASI_Rn02_00389276 predicted 2877
10 SASI_Rn02_00389277 predicted 680
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_029640 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00023507 predicted 2251
2 SASI_Mm01_00023508 predicted 2293
3 SASI_Mm01_00023509 predicted 1307
4 SASI_Mm01_00023510 predicted 658
5 SASI_Mm01_00023511 predicted 3022
6 SASI_Mm01_00023512 predicted 2346
7 SASI_Mm01_00023513 predicted 1358
8 SASI_Mm01_00023514 predicted 1210
9 SASI_Mm01_00023515 predicted 2301
10 SASI_Mm01_00023516 predicted 574
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_180662 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00063448 predicted 2997
2 SASI_Mm01_00063449 predicted 3039
3 SASI_Mm01_00063450 predicted 2048
4 SASI_Mm01_00063451 predicted 1412
5 SASI_Mm01_00063452 predicted 3767
6 SASI_Mm01_00063453 predicted 3098
7 SASI_Mm01_00063454 predicted 2109
8 SASI_Mm01_00063455 predicted 1955
9 SASI_Mm01_00063456 predicted 3052
10 SASI_Mm01_00063457 predicted 1328
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029640
VALIDATED
TRAPPC9 MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 9
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029640.1-1220s1c1
Sequence:CCGGCGTGGAGAAGAACGCAACAAACTCGAGTTTGTTGCGTTCTTCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029640.1-1198s21c1
Sequence:CCGGTTCGCCAATCATCGCACATAACTCGAGTTATGTGCGATGATTGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029640.1-438s21c1
Sequence:CCGGCCGAGGACATCATTGACAAATCTCGAGATTTGTCAATGATGTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029640.1-460s1c1
Sequence:CCGGCAAAGAGGCCATCTCCTATTACTCGAGTAATAGGAGATGGCCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029640.1-3029s21c1
Sequence:CCGGTTATGCTGAGCGACCTCATATCTCGAGATATGAGGTCGCTCAGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029640.1-1651s21c1
Sequence:CCGGTCAGCTGTACAACGGAGAAACCTCGAGGTTTCTCCGTTGTACAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000246674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029640.1-228s21c1
Sequence:CCGGGCTCGGCTTCAGTCATTTATCCTCGAGGATAAATGACTGAAGCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029640
VALIDATED
TRAPPC9 MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 9
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029640.1-1220s1c1
Sequence:CCGGCGTGGAGAAGAACGCAACAAACTCGAGTTTGTTGCGTTCTTCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029640.1-1198s21c1
Sequence:CCGGTTCGCCAATCATCGCACATAACTCGAGTTATGTGCGATGATTGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029640.1-438s21c1
Sequence:CCGGCCGAGGACATCATTGACAAATCTCGAGATTTGTCAATGATGTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029640.1-460s1c1
Sequence:CCGGCAAAGAGGCCATCTCCTATTACTCGAGTAATAGGAGATGGCCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029640.1-3029s21c1
Sequence:CCGGTTATGCTGAGCGACCTCATATCTCGAGATATGAGGTCGCTCAGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029640.1-1651s21c1
Sequence:CCGGTCAGCTGTACAACGGAGAAACCTCGAGGTTTCTCCGTTGTACAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000246674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029640.1-228s21c1
Sequence:CCGGGCTCGGCTTCAGTCATTTATCCTCGAGGATAAATGACTGAAGCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029640
VALIDATED
TRAPPC9 MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 9
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201938    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029640.1-1220s1c1
Sequence:CCGGCGTGGAGAAGAACGCAACAAACTCGAGTTTGTTGCGTTCTTCTCCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246676    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029640.1-1198s21c1
Sequence:CCGGTTCGCCAATCATCGCACATAACTCGAGTTATGTGCGATGATTGGCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246678    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029640.1-438s21c1
Sequence:CCGGCCGAGGACATCATTGACAAATCTCGAGATTTGTCAATGATGTCCTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217073    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_029640.1-460s1c1
Sequence:CCGGCAAAGAGGCCATCTCCTATTACTCGAGTAATAGGAGATGGCCTCTTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246677    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_029640.1-3029s21c1
Sequence:CCGGTTATGCTGAGCGACCTCATATCTCGAGATATGAGGTCGCTCAGCATAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246675    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.67 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029640.1-1651s21c1
Sequence:CCGGTCAGCTGTACAACGGAGAAACCTCGAGGTTTCTCCGTTGTACAGCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000246674    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.76 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_029640.1-228s21c1
Sequence:CCGGGCTCGGCTTCAGTCATTTATCCTCGAGGATAAATGACTGAAGCCGAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031466
TRAPPC9 MISSION shRNA Bacterial Glycerol Stock
trafficking protein particle complex 9
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000118842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031466.3-4139s1c1
Sequence:CCGGCCTTTGGCCATAGAAAGAAATCTCGAGATTTCTTTCTATGGCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031466.3-1064s1c1
Sequence:CCGGGCTTCTGTCATCTATCACTATCTCGAGATAGTGATAGATGACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031466.3-2139s1c1
Sequence:CCGGCGTTTGAACTTCGAGTTGAAACTCGAGTTTCAACTCGAAGTTCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031466.3-2565s1c1
Sequence:CCGGCCTCGAAAGTTCTCACCACTACTCGAGTAGTGGTGAGAACTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000118844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031466.3-2138s1c1
Sequence:CCGGCCGTTTGAACTTCGAGTTGAACTCGAGTTCAACTCGAAGTTCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031466.5-2261s21c1
Sequence:CCGGCGCAGACGACTGGAACGATTACTCGAGTAATCGTTCCAGTCGTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031466.5-396s21c1
Sequence:CCGGGAACTTCTTCAGGATCTATAACTCGAGTTATAGATCCTGAAGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000427771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031466.5-2452s21c1
Sequence:CCGGGGTGATGAAATATCTACTAATCTCGAGATTAGTAGATATTTCATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031466
TRAPPC9 MISSION shRNA shRNA Plasmid DNA
trafficking protein particle complex 9
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000118842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031466.3-4139s1c1
Sequence:CCGGCCTTTGGCCATAGAAAGAAATCTCGAGATTTCTTTCTATGGCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031466.3-1064s1c1
Sequence:CCGGGCTTCTGTCATCTATCACTATCTCGAGATAGTGATAGATGACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031466.3-2139s1c1
Sequence:CCGGCGTTTGAACTTCGAGTTGAAACTCGAGTTTCAACTCGAAGTTCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031466.3-2565s1c1
Sequence:CCGGCCTCGAAAGTTCTCACCACTACTCGAGTAGTGGTGAGAACTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000118844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031466.3-2138s1c1
Sequence:CCGGCCGTTTGAACTTCGAGTTGAACTCGAGTTCAACTCGAAGTTCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031466.5-2261s21c1
Sequence:CCGGCGCAGACGACTGGAACGATTACTCGAGTAATCGTTCCAGTCGTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031466.5-396s21c1
Sequence:CCGGGAACTTCTTCAGGATCTATAACTCGAGTTATAGATCCTGAAGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000427771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031466.5-2452s21c1
Sequence:CCGGGGTGATGAAATATCTACTAATCTCGAGATTAGTAGATATTTCATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031466
TRAPPC9 MISSION shRNA Lentiviral Transduction Particles
trafficking protein particle complex 9
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000118842    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031466.3-4139s1c1
Sequence:CCGGCCTTTGGCCATAGAAAGAAATCTCGAGATTTCTTTCTATGGCCAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118846    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031466.3-1064s1c1
Sequence:CCGGGCTTCTGTCATCTATCACTATCTCGAGATAGTGATAGATGACAGAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118843    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031466.3-2139s1c1
Sequence:CCGGCGTTTGAACTTCGAGTTGAAACTCGAGTTTCAACTCGAAGTTCAAACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118845    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031466.3-2565s1c1
Sequence:CCGGCCTCGAAAGTTCTCACCACTACTCGAGTAGTGGTGAGAACTTTCGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000118844    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031466.3-2138s1c1
Sequence:CCGGCCGTTTGAACTTCGAGTTGAACTCGAGTTCAACTCGAAGTTCAAACGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436335    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031466.5-2261s21c1
Sequence:CCGGCGCAGACGACTGGAACGATTACTCGAGTAATCGTTCCAGTCGTCTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428885    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031466.5-396s21c1
Sequence:CCGGGAACTTCTTCAGGATCTATAACTCGAGTTATAGATCCTGAAGAAGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000427771    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031466.5-2452s21c1
Sequence:CCGGGGTGATGAAATATCTACTAATCTCGAGATTAGTAGATATTTCATCACCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks