EMAIL THIS PAGE TO A FRIEND

TRAT1

T cell receptor associated transmembrane adaptor 1

Synonyms: TCRIM TRIM
UniProtKB ID: Q6PIZ9, Q9NZX5
Gene ID:
Mouse(77647) T cell receptor associated transmembrane adaptor 1
Rat(498075) T cell receptor associated transmembrane adaptor 1
chicken(418412) T cell receptor associated transmembrane adaptor 1
dog(478556) T cell receptor associated transmembrane adaptor 1
cow(614942) T cell receptor associated transmembrane adaptor 1
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198297 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_198297 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_198297 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_016388 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016388 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016388 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016388 Rosetta Predictions human pricing
NM_001037981 Rosetta Predictions rat pricing
NM_198297 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016388 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00236451 predicted 671
2 SASI_Hs01_00236452 predicted 704
3 SASI_Hs01_00236453 predicted 720
4 SASI_Hs01_00236454 predicted 648
5 SASI_Hs01_00236455 predicted 566
6 SASI_Hs01_00236456 predicted 694
7 SASI_Hs01_00236457 predicted 316
8 SASI_Hs01_00236458 predicted 474
9 SASI_Hs01_00236459 predicted 708
10 SASI_Hs01_00236460 predicted 328
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001037981 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00063335 predicted 676
2 SASI_Rn02_00204668 predicted 564
3 SASI_Rn01_00063336 predicted 256
4 SASI_Rn01_00063337 predicted 788
5 SASI_Rn02_00204669 predicted 426
6 SASI_Rn02_00204670 predicted 831
7 SASI_Rn01_00063339 predicted 272
8 SASI_Rn01_00063340 predicted 625
9 SASI_Rn01_00063341 predicted 760
10 SASI_Rn02_00204671 predicted 767
11 SASI_Rn01_00063338 predicted 793
12 SASI_Rn01_00063342 predicted 748
13 SASI_Rn01_00063343 predicted 376
14 SASI_Rn01_00063344 predicted 325
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198297 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00350919 predicted 408
2 SASI_Mm02_00350920 predicted 429
3 SASI_Mm02_00350921 predicted 265
4 SASI_Mm02_00350922 predicted 253
5 SASI_Mm01_00024900 predicted 199
6 SASI_Mm02_00350923 predicted 204
7 SASI_Mm02_00350924 predicted 461
8 SASI_Mm02_00350925 predicted 371
9 SASI_Mm02_00350926 predicted 442
10 SASI_Mm02_00350927 predicted 404
11 SASI_Mm01_00024892 predicted 333
12 SASI_Mm01_00024893 predicted 285
13 SASI_Mm01_00024894 predicted 658
14 SASI_Mm01_00024895 predicted 625
15 SASI_Mm01_00024896 predicted 783
16 SASI_Mm01_00024897 predicted 651
17 SASI_Mm01_00024898 predicted 694
18 SASI_Mm01_00024899 predicted 813
19 SASI_Mm01_00024901 predicted 301
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198297
TRAT1 MISSION shRNA Bacterial Glycerol Stock
T cell receptor associated transmembrane adaptor 1
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000436756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198297.3-577s21c1
Sequence:CCGGGCCAAGAGAGAGCCTGTAATCCTCGAGGATTACAGGCTCTCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000432320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198297.3-143s21c1
Sequence:CCGCAGCAGAGACGAGATGAAATATCTCGAGATATTTCATCTCGTCTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198297.3-474s21c1
Sequence:CCGGCAACGTTTCTCAGATCAATATCTCGAGATATTGATCTGAGAAACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198297.3-498s21c1
Sequence:CCGGAGAAAGTTTCCCACCAGATAACTCGAGTTATCTGGTGGGAAACTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198297.2-1954s1c1
Sequence:CCGGCCTTAGATTCTAAAGGCTTATCTCGAGATAAGCCTTTAGAATCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198297.2-393s1c1
Sequence:CCGGGATGCTCCAATTTATGGCAATCTCGAGATTGCCATAAATTGGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198297.2-278s1c1
Sequence:CCGGTCTGGTTATATCGTTGATCTTCTCGAGAAGATCAACGATATAACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198297.2-622s1c1
Sequence:CCGGGAAAGGATACACAAGTCTATACTCGAGTATAGACTTGTGTATCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000124065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198297.2-731s1c1
Sequence:CCGGCGCTAGACTGTTTGGGTTGATCTCGAGATCAACCCAAACAGTCTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198297
TRAT1 MISSION shRNA shRNA Plasmid DNA
T cell receptor associated transmembrane adaptor 1
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000436756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198297.3-577s21c1
Sequence:CCGGGCCAAGAGAGAGCCTGTAATCCTCGAGGATTACAGGCTCTCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000432320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198297.3-143s21c1
Sequence:CCGCAGCAGAGACGAGATGAAATATCTCGAGATATTTCATCTCGTCTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198297.3-474s21c1
Sequence:CCGGCAACGTTTCTCAGATCAATATCTCGAGATATTGATCTGAGAAACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198297.3-498s21c1
Sequence:CCGGAGAAAGTTTCCCACCAGATAACTCGAGTTATCTGGTGGGAAACTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198297.2-1954s1c1
Sequence:CCGGCCTTAGATTCTAAAGGCTTATCTCGAGATAAGCCTTTAGAATCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198297.2-393s1c1
Sequence:CCGGGATGCTCCAATTTATGGCAATCTCGAGATTGCCATAAATTGGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198297.2-278s1c1
Sequence:CCGGTCTGGTTATATCGTTGATCTTCTCGAGAAGATCAACGATATAACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198297.2-622s1c1
Sequence:CCGGGAAAGGATACACAAGTCTATACTCGAGTATAGACTTGTGTATCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000124065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198297.2-731s1c1
Sequence:CCGGCGCTAGACTGTTTGGGTTGATCTCGAGATCAACCCAAACAGTCTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198297
TRAT1 MISSION shRNA Lentiviral Transduction Particles
T cell receptor associated transmembrane adaptor 1
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000436756    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198297.3-577s21c1
Sequence:CCGGGCCAAGAGAGAGCCTGTAATCCTCGAGGATTACAGGCTCTCTCTTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000432320    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198297.3-143s21c1
Sequence:CCGCAGCAGAGACGAGATGAAATATCTCGAGATATTTCATCTCGTCTCTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416216    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198297.3-474s21c1
Sequence:CCGGCAACGTTTCTCAGATCAATATCTCGAGATATTGATCTGAGAAACGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430040    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_198297.3-498s21c1
Sequence:CCGGAGAAAGTTTCCCACCAGATAACTCGAGTTATCTGGTGGGAAACTTTCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124064    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_198297.2-1954s1c1
Sequence:CCGGCCTTAGATTCTAAAGGCTTATCTCGAGATAAGCCTTTAGAATCTAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124068    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198297.2-393s1c1
Sequence:CCGGGATGCTCCAATTTATGGCAATCTCGAGATTGCCATAAATTGGAGCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124067    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198297.2-278s1c1
Sequence:CCGGTCTGGTTATATCGTTGATCTTCTCGAGAAGATCAACGATATAACCAGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124066    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198297.2-622s1c1
Sequence:CCGGGAAAGGATACACAAGTCTATACTCGAGTATAGACTTGTGTATCCTTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000124065    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198297.2-731s1c1
Sequence:CCGGCGCTAGACTGTTTGGGTTGATCTCGAGATCAACCCAAACAGTCTAGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016388
TRAT1 MISSION shRNA Bacterial Glycerol Stock
T cell receptor associated transmembrane adaptor 1
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000412964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016388.2-1029s21c1
Sequence:CCGGATACCTAATACTTAGGGAAATCTCGAGATTTCCCTAAGTATTAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016388.2-681s21c1
Sequence:CCGGTGCTAAGAGAGAACCTATAAACTCGAGTTTATAGGTTCTCTCTTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016388.2-712s21c1
Sequence:CCGGCATGATCTAGTTCAATGATTTCTCGAGAAATCATTGAACTAGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016388.2-331s21c1
Sequence:CCGGTATGGTAACTTAGATGATATGCTCGAGCATATCATCTAAGTTACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016388.1-397s1c1
Sequence:CCGGCCGACCAGAGAAATCTGTAAACTCGAGTTTACAGATTTCTCTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016388.1-554s1c1
Sequence:CCGGGATGAGCAACTACATGCAATACTCGAGTATTGCATGTAGTTGCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016388.1-477s1c1
Sequence:CCGGCCTCACTTGATCACAGCGTTACTCGAGTAACGCTGTGATCAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016388.1-580s1c1
Sequence:CCGGCAGCGTTTCTAAGACCACCTTCTCGAGAAGGTGGTCTTAGAAACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000062946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016388.1-293s1c1
Sequence:CCGGACCAGGGTTGATGAGTATTATCTCGAGATAATACTCATCAACCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016388
TRAT1 MISSION shRNA shRNA Plasmid DNA
T cell receptor associated transmembrane adaptor 1
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000412964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016388.2-1029s21c1
Sequence:CCGGATACCTAATACTTAGGGAAATCTCGAGATTTCCCTAAGTATTAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016388.2-681s21c1
Sequence:CCGGTGCTAAGAGAGAACCTATAAACTCGAGTTTATAGGTTCTCTCTTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016388.2-712s21c1
Sequence:CCGGCATGATCTAGTTCAATGATTTCTCGAGAAATCATTGAACTAGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016388.2-331s21c1
Sequence:CCGGTATGGTAACTTAGATGATATGCTCGAGCATATCATCTAAGTTACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016388.1-397s1c1
Sequence:CCGGCCGACCAGAGAAATCTGTAAACTCGAGTTTACAGATTTCTCTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016388.1-554s1c1
Sequence:CCGGGATGAGCAACTACATGCAATACTCGAGTATTGCATGTAGTTGCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016388.1-477s1c1
Sequence:CCGGCCTCACTTGATCACAGCGTTACTCGAGTAACGCTGTGATCAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016388.1-580s1c1
Sequence:CCGGCAGCGTTTCTAAGACCACCTTCTCGAGAAGGTGGTCTTAGAAACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000062946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016388.1-293s1c1
Sequence:CCGGACCAGGGTTGATGAGTATTATCTCGAGATAATACTCATCAACCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016388
TRAT1 MISSION shRNA Lentiviral Transduction Particles
T cell receptor associated transmembrane adaptor 1
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000412964    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016388.2-1029s21c1
Sequence:CCGGATACCTAATACTTAGGGAAATCTCGAGATTTCCCTAAGTATTAGGTATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414074    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016388.2-681s21c1
Sequence:CCGGTGCTAAGAGAGAACCTATAAACTCGAGTTTATAGGTTCTCTCTTAGCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416754    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016388.2-712s21c1
Sequence:CCGGCATGATCTAGTTCAATGATTTCTCGAGAAATCATTGAACTAGATCATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436059    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_016388.2-331s21c1
Sequence:CCGGTATGGTAACTTAGATGATATGCTCGAGCATATCATCTAAGTTACCATATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016388.1-397s1c1
Sequence:CCGGCCGACCAGAGAAATCTGTAAACTCGAGTTTACAGATTTCTCTGGTCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062947    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016388.1-554s1c1
Sequence:CCGGGATGAGCAACTACATGCAATACTCGAGTATTGCATGTAGTTGCTCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016388.1-477s1c1
Sequence:CCGGCCTCACTTGATCACAGCGTTACTCGAGTAACGCTGTGATCAAGTGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062945    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016388.1-580s1c1
Sequence:CCGGCAGCGTTTCTAAGACCACCTTCTCGAGAAGGTGGTCTTAGAAACGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000062946    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016388.1-293s1c1
Sequence:CCGGACCAGGGTTGATGAGTATTATCTCGAGATAATACTCATCAACCCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks