EMAIL THIS PAGE TO A FRIEND

TRDMT1

tRNA aspartic acid methyltransferase 1

Synonyms: DMNT2 DNMT2 MHSAIIP PUMET RNMT1
Gene ID:
Human(1787) Summary: This gene encodes a protein responsible for the methylation of aspartic acid transfer RNA, specifically at the cytosine-38 residue in the anticodon loop. This enzyme also possesses residual DNA-(cytosine-C5) methyltransferase activity. While similar in sequence and structure to DNA cytosine methyltransferases, this gene is distinct and highly conserved in its function among taxa. [provided by RefSeq, Jun 2010]
Mouse(13434) tRNA aspartic acid methyltransferase 1
Rat(291324) tRNA aspartic acid methyltransferase 1
Zebrafish(449878) tRNA aspartic acid methyltransferase 1
domestic cat(101091708) tRNA aspartic acid methyltransferase 1
dog(487116) tRNA aspartic acid methyltransferase 1
chicken(420520) tRNA aspartic acid methyltransferase 1
cow(353353) tRNA aspartic acid methyltransferase 1
domestic guinea pig(100720839) tRNA aspartic acid methyltransferase 1
Domestic Rabbit(100346643) tRNA aspartic acid methyltransferase 1
naked mole-rat(101719891) tRNA aspartic acid methyltransferase 1
127 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1305374 ANTI-DNMT2 antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
SAB1300511 Anti-Mouse Dnmt2 (N-term) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse, human
ELISA, immunohistochemistry, western blot pricing
SAB1305377 ANTI-MOUSE DNMT2(N-TERMINAL) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human, mouse
immunohistochemistry, western blot pricing
T0330 Anti-TRDMT1 (81-95) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
western blot pricing
SAB1405724 Anti-TRDMT1 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
SAB2102534 Anti-TRDMT1 antibody produced in rabbit affinity isolated antibody mouse, canine, pig, human, guinea pig, rat, rabbit, bovine, horse
western blot pricing
HPA036945 Anti-TRDMT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunohistochemistry, western blot pricing
SAB1410304 Anti-TRDMT1 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA036946 Anti-TRDMT1 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry pricing
WH0001787M1 Monoclonal Anti-DNMT2 antibody produced in mouse clone 1E12, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_010067 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_010067 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_010067 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_004412 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_004412 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_004412 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_004412 Rosetta Predictions human pricing
NM_176081 Rosetta Predictions human pricing
NM_176083 Rosetta Predictions human pricing
NM_176085 Rosetta Predictions human pricing
NM_176086 Rosetta Predictions human pricing
NM_001031643 Rosetta Predictions rat pricing
NM_010067 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_004412 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00107954 predicted 1160
2 SASI_Hs01_00107955 predicted 689
3 SASI_Hs01_00107956 predicted 999
4 SASI_Hs01_00107957 predicted 851
5 SASI_Hs01_00107959 predicted 1151
6 SASI_Hs01_00107960 predicted 1062
7 SASI_Hs01_00107961 predicted 775
8 SASI_Hs01_00107962 predicted 743
9 SASI_Hs02_00337558 predicted 1289
10 SASI_Hs02_00337559 predicted 859
11 SASI_Hs01_00107953 predicted 1244
12 SASI_Hs01_00107958 predicted 1276
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176081 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00168103 predicted 1022
2 SASI_Hs01_00168104 predicted 552
3 SASI_Hs01_00168105 predicted 865
4 SASI_Hs01_00168106 predicted 711
5 SASI_Hs01_00168108 predicted 1006
6 SASI_Hs01_00168109 predicted 921
7 SASI_Hs01_00168110 predicted 634
8 SASI_Hs01_00168111 predicted 607
9 SASI_Hs02_00369196 predicted 1150
10 SASI_Hs02_00369197 predicted 719
11 SASI_Hs01_00168102 predicted 1108
12 SASI_Hs01_00168107 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176083 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00076280 predicted 1090
2 SASI_Hs01_00076281 predicted 614
3 SASI_Hs01_00076282 predicted 927
4 SASI_Hs01_00076283 predicted 777
5 SASI_Hs01_00076285 predicted 1079
6 SASI_Hs01_00076286 predicted 992
7 SASI_Hs01_00076287 predicted 704
8 SASI_Hs01_00076288 predicted 670
9 SASI_Hs02_00369198 predicted 1222
10 SASI_Hs02_00369199 predicted 784
11 SASI_Hs01_00076279 predicted 1178
12 SASI_Hs01_00076284 predicted 1204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176085 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00173716 predicted 546
2 SASI_Hs01_00173717 predicted 709
3 SASI_Hs01_00173718 predicted 207
4 SASI_Hs01_00173719 predicted 406
5 SASI_Hs01_00173720 predicted 198
6 SASI_Hs01_00173721 predicted 287
7 SASI_Hs01_00173722 predicted 684
8 SASI_Hs01_00173723 predicted 209
9 SASI_Hs01_00173724 predicted 629
10 SASI_Hs01_00173725 predicted 601
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_176086 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00060434 predicted 473
2 SASI_Hs01_00060435 predicted 793
3 SASI_Hs01_00060436 predicted 645
4 SASI_Hs01_00060437 predicted 614
5 SASI_Hs01_00060438 predicted 848
6 SASI_Hs01_00060439 predicted 897
7 SASI_Hs01_00060440 predicted 765
8 SASI_Hs01_00060441 predicted 779
9 SASI_Hs01_00060442 predicted 568
10 SASI_Hs01_00060443 predicted 535
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001031643 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00081765 predicted 968
2 SASI_Rn02_00203578 predicted 208
3 SASI_Rn01_00081766 predicted 356
4 SASI_Rn01_00081767 predicted 311
5 SASI_Rn01_00081768 predicted 1062
6 SASI_Rn01_00081769 predicted 386
7 SASI_Rn01_00081770 predicted 230
8 SASI_Rn01_00081771 predicted 982
9 SASI_Rn01_00081772 predicted 1031
10 SASI_Rn01_00081773 predicted 1017
11 SASI_Rn01_00081774 predicted 1051
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_010067 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00166065 predicted 1091
2 SASI_Mm01_00166067 predicted 798
3 SASI_Mm01_00166068 predicted 857
4 SASI_Mm01_00166069 predicted 318
5 SASI_Mm01_00166070 predicted 1239
6 SASI_Mm02_00317742 predicted 1100
7 SASI_Mm02_00317743 predicted 1236
8 SASI_Mm01_00166071 predicted 1326
9 SASI_Mm01_00166072 predicted 713
10 SASI_Mm01_00166073 predicted 1292
11 SASI_Mm01_00166064 predicted 1370
12 SASI_Mm01_00166066 predicted 208
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_010067
VALIDATED
TRDMT1 MISSION shRNA Bacterial Glycerol Stock
tRNA aspartic acid methyltransferase 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000328293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010067.4-1288s21c1
Sequence:CCGGCTTATAGAGTTCAGCTAAATTCTCGAGAATTTAGCTGAACTCTATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010067.4-86s21c1
Sequence:CCGGCGCGCTGCGAGAAAGTCATATCTCGAGATATGACTTTCTCGCAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010067.4-222s21c1
Sequence:CCGGGACTTTGACAAGCTATCTTTCCTCGAGGAAAGATAGCTTGTCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010067.4-1039s21c1
Sequence:CCGGCAATGCTTAAACTGCGATATTCTCGAGAATATCGCAGTTTAAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000328296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010067.4-1231s21c1
Sequence:CCGGGTCACAAGATGCCGCTAATTCCTCGAGGAATTAGCGGCATCTTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010067.2-2089s1c1
Sequence:CCGGCCCTCAACATTCAACAGGTAACTCGAGTTACCTGTTGAATGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010067.2-370s1c1
Sequence:CCGGCCCAAGTATATTCTCTTAGAACTCGAGTTCTAAGAGAATATACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010067.2-815s1c1
Sequence:CCGGGCGACACAGATGAGTACCTTTCTCGAGAAAGGTACTCATCTGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010067.2-1243s1c1
Sequence:CCGGCCGCTAATTCTAGATAGTAATCTCGAGATTACTATCTAGAATTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000039033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010067.2-1086s1c1
Sequence:CCGGCCAGGGATTTCCTCCAGAATTCTCGAGAATTCTGGAGGAAATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_010067
VALIDATED
TRDMT1 MISSION shRNA shRNA Plasmid DNA
tRNA aspartic acid methyltransferase 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000328293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010067.4-1288s21c1
Sequence:CCGGCTTATAGAGTTCAGCTAAATTCTCGAGAATTTAGCTGAACTCTATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010067.4-86s21c1
Sequence:CCGGCGCGCTGCGAGAAAGTCATATCTCGAGATATGACTTTCTCGCAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010067.4-222s21c1
Sequence:CCGGGACTTTGACAAGCTATCTTTCCTCGAGGAAAGATAGCTTGTCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010067.4-1039s21c1
Sequence:CCGGCAATGCTTAAACTGCGATATTCTCGAGAATATCGCAGTTTAAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000328296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010067.4-1231s21c1
Sequence:CCGGGTCACAAGATGCCGCTAATTCCTCGAGGAATTAGCGGCATCTTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010067.2-2089s1c1
Sequence:CCGGCCCTCAACATTCAACAGGTAACTCGAGTTACCTGTTGAATGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010067.2-370s1c1
Sequence:CCGGCCCAAGTATATTCTCTTAGAACTCGAGTTCTAAGAGAATATACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010067.2-815s1c1
Sequence:CCGGGCGACACAGATGAGTACCTTTCTCGAGAAAGGTACTCATCTGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010067.2-1243s1c1
Sequence:CCGGCCGCTAATTCTAGATAGTAATCTCGAGATTACTATCTAGAATTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000039033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010067.2-1086s1c1
Sequence:CCGGCCAGGGATTTCCTCCAGAATTCTCGAGAATTCTGGAGGAAATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_010067
VALIDATED
TRDMT1 MISSION shRNA Lentiviral Transduction Particles
tRNA aspartic acid methyltransferase 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000328293    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.87 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010067.4-1288s21c1
Sequence:CCGGCTTATAGAGTTCAGCTAAATTCTCGAGAATTTAGCTGAACTCTATAAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328225    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010067.4-86s21c1
Sequence:CCGGCGCGCTGCGAGAAAGTCATATCTCGAGATATGACTTTCTCGCAGCGCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328223    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010067.4-222s21c1
Sequence:CCGGGACTTTGACAAGCTATCTTTCCTCGAGGAAAGATAGCTTGTCAAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328295    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_010067.4-1039s21c1
Sequence:CCGGCAATGCTTAAACTGCGATATTCTCGAGAATATCGCAGTTTAAGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000328296    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.55 Cell Line: NIH/3T3
TRC Version: 2 Clone ID:NM_010067.4-1231s21c1
Sequence:CCGGGTCACAAGATGCCGCTAATTCCTCGAGGAATTAGCGGCATCTTGTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039029    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_010067.2-2089s1c1
Sequence:CCGGCCCTCAACATTCAACAGGTAACTCGAGTTACCTGTTGAATGTTGAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039030    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_010067.2-370s1c1
Sequence:CCGGCCCAAGTATATTCTCTTAGAACTCGAGTTCTAAGAGAATATACTTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039031    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.54 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010067.2-815s1c1
Sequence:CCGGGCGACACAGATGAGTACCTTTCTCGAGAAAGGTACTCATCTGTGTCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039032    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.66 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010067.2-1243s1c1
Sequence:CCGGCCGCTAATTCTAGATAGTAATCTCGAGATTACTATCTAGAATTAGCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000039033    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.65 Cell Line: NIH/3T3
TRC Version: 1 Clone ID:NM_010067.2-1086s1c1
Sequence:CCGGCCAGGGATTTCCTCCAGAATTCTCGAGAATTCTGGAGGAAATCCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_004412
VALIDATED
TRDMT1 MISSION shRNA Bacterial Glycerol Stock
tRNA aspartic acid methyltransferase 1
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000234957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004412.4-2489s21c1
Sequence:CCGGAGCGTTTATAACACCATTATTCTCGAGAATAATGGTGTTATAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004412.4-1181s21c1
Sequence:CCGGACGTGCATGTAGTAGCTAAACCTCGAGGTTTAGCTACTACATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004412.4-1057s21c1
Sequence:CCGGATACTTAAACTGCGATATTTCCTCGAGGAAATATCGCAGTTTAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004412.4-518s21c1
Sequence:CCGGCAAATTCAAGGCTACGATATTCTCGAGAATATCGTAGCCTTGAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000234953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004412.4-149s21c1
Sequence:CCGGATGTCAACACTGTCGCTAATGCTCGAGCATTAGCGACAGTGTTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004412.3-751s1c1
Sequence:CCGGGCAGAAGAAATTCACAGGAAACTCGAGTTTCCTGTGAATTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004412.3-918s1c1
Sequence:CCGGCGTGTGCTTTACCAAAGGATACTCGAGTATCCTTTGGTAAAGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004412.3-208s1c1
Sequence:CCGGGCCAAGACGATTGAAGGCATTCTCGAGAATGCCTTCAATCGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_004412.3-856s1c1
Sequence:CCGGCCAAAGTCATTGCTGCGATATCTCGAGATATCGCAGCAATGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000035651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004412.3-103s1c1
Sequence:CCGGGCGCTGAGAGAAAGCTGTATACTCGAGTATACAGCTTTCTCTCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_004412
VALIDATED
TRDMT1 MISSION shRNA shRNA Plasmid DNA
tRNA aspartic acid methyltransferase 1
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000234957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004412.4-2489s21c1
Sequence:CCGGAGCGTTTATAACACCATTATTCTCGAGAATAATGGTGTTATAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004412.4-1181s21c1
Sequence:CCGGACGTGCATGTAGTAGCTAAACCTCGAGGTTTAGCTACTACATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004412.4-1057s21c1
Sequence:CCGGATACTTAAACTGCGATATTTCCTCGAGGAAATATCGCAGTTTAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004412.4-518s21c1
Sequence:CCGGCAAATTCAAGGCTACGATATTCTCGAGAATATCGTAGCCTTGAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000234953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004412.4-149s21c1
Sequence:CCGGATGTCAACACTGTCGCTAATGCTCGAGCATTAGCGACAGTGTTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004412.3-751s1c1
Sequence:CCGGGCAGAAGAAATTCACAGGAAACTCGAGTTTCCTGTGAATTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004412.3-918s1c1
Sequence:CCGGCGTGTGCTTTACCAAAGGATACTCGAGTATCCTTTGGTAAAGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004412.3-208s1c1
Sequence:CCGGGCCAAGACGATTGAAGGCATTCTCGAGAATGCCTTCAATCGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_004412.3-856s1c1
Sequence:CCGGCCAAAGTCATTGCTGCGATATCTCGAGATATCGCAGCAATGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000035651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004412.3-103s1c1
Sequence:CCGGGCGCTGAGAGAAAGCTGTATACTCGAGTATACAGCTTTCTCTCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_004412
VALIDATED
TRDMT1 MISSION shRNA Lentiviral Transduction Particles
tRNA aspartic acid methyltransferase 1
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000234957    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_004412.4-2489s21c1
Sequence:CCGGAGCGTTTATAACACCATTATTCTCGAGAATAATGGTGTTATAAACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234956    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004412.4-1181s21c1
Sequence:CCGGACGTGCATGTAGTAGCTAAACCTCGAGGTTTAGCTACTACATGCACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234955    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004412.4-1057s21c1
Sequence:CCGGATACTTAAACTGCGATATTTCCTCGAGGAAATATCGCAGTTTAAGTATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004412.4-518s21c1
Sequence:CCGGCAAATTCAAGGCTACGATATTCTCGAGAATATCGTAGCCTTGAATTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000234953    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_004412.4-149s21c1
Sequence:CCGGATGTCAACACTGTCGCTAATGCTCGAGCATTAGCGACAGTGTTGACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035649    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004412.3-751s1c1
Sequence:CCGGGCAGAAGAAATTCACAGGAAACTCGAGTTTCCTGTGAATTTCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035650    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004412.3-918s1c1
Sequence:CCGGCGTGTGCTTTACCAAAGGATACTCGAGTATCCTTTGGTAAAGCACACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035652    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004412.3-208s1c1
Sequence:CCGGGCCAAGACGATTGAAGGCATTCTCGAGAATGCCTTCAATCGTCTTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035653    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: A3
TRC Version: 1 Clone ID:NM_004412.3-856s1c1
Sequence:CCGGCCAAAGTCATTGCTGCGATATCTCGAGATATCGCAGCAATGACTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000035651    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_004412.3-103s1c1
Sequence:CCGGGCGCTGAGAGAAAGCTGTATACTCGAGTATACAGCTTTCTCTCAGCGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks