EMAIL THIS PAGE TO A FRIEND

TRDN

triadin

Synonyms: TDN TRISK
UniProtKB ID: Q13061, A5D6W5, F5H2W7, Q6NSB8
Gene ID:
Human(10345) Summary: This gene encodes an integral membrane protein that contains a single transmembrane domain. As similar protein in rabbits plays a role in skeletal muscle excitation-contraction coupling as part of the calcium release complex in association with the ryanodine receptor. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and single nucleotide polymorphisms in this gene may be markers for IgA nephritis. [provided by RefSeq, Oct 2011]
Mouse(76757) triadin
Rat(59299) triadin
cow(534061) triadin
chicken(421721) triadin
dog(403776) triadin
265 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006073 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006073 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006073 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_029726 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_029726 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_029726 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU123171 MISSION® esiRNA esiRNA human TRDN (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006073 Rosetta Predictions human pricing
NM_021666 Rosetta Predictions rat pricing
XM_483889 Rosetta Predictions mouse pricing
XM_483890 Rosetta Predictions mouse pricing
XM_890360 Rosetta Predictions mouse pricing
XM_898960 Rosetta Predictions mouse pricing
XM_906658 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006073 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00022332 predicted 2357
2 SASI_Hs01_00022333 predicted 2184
3 SASI_Hs01_00022334 predicted 1527
4 SASI_Hs01_00022336 predicted 2377
5 SASI_Hs01_00022337 predicted 208
6 SASI_Hs01_00022338 predicted 2466
7 SASI_Hs01_00022340 predicted 2117
8 SASI_Hs02_00340841 predicted 2192
9 SASI_Hs02_00340842 predicted 2399
10 SASI_Hs02_00340843 predicted 2468
11 SASI_Hs01_00022335 predicted 1437
12 SASI_Hs01_00022339 predicted 1640
13 SASI_Hs01_00022341 predicted 2370
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021666 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00118956 predicted 2145
2 SASI_Rn01_00118957 predicted 1465
3 SASI_Rn01_00118958 predicted 2238
4 SASI_Rn01_00118959 predicted 2225
5 SASI_Rn02_00262675 predicted 2533
6 SASI_Rn01_00118960 predicted 2307
7 SASI_Rn01_00118961 predicted 1953
8 SASI_Rn01_00118963 predicted 1438
9 SASI_Rn02_00262676 predicted 2482
10 SASI_Rn01_00118964 predicted 2499
11 SASI_Rn01_00118962 predicted 2355
12 SASI_Rn01_00118965 predicted 2029
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_483889 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00276538 predicted 980
2 SASI_Mm01_00276539 predicted 1030
3 SASI_Mm01_00276540 predicted 436
4 SASI_Mm01_00276541 predicted 432
5 SASI_Mm01_00276542 predicted 583
6 SASI_Mm01_00276543 predicted 1206
7 SASI_Mm01_00276544 predicted 616
8 SASI_Mm01_00276545 predicted 934
9 SASI_Mm01_00276546 predicted 1095
10 SASI_Mm01_00276547 predicted 1151
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_483890 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00426351 predicted 983
2 SASI_Mm02_00426352 predicted 1033
3 SASI_Mm02_00426353 predicted 433
4 SASI_Mm02_00426354 predicted 430
5 SASI_Mm01_00267411 predicted 1906
6 SASI_Mm02_00426355 predicted 577
7 SASI_Mm02_00426356 predicted 436
8 SASI_Mm02_00426357 predicted 925
9 SASI_Mm01_00267416 predicted 1794
10 SASI_Mm02_00426358 predicted 354
11 SASI_Mm01_00267410 predicted 1061
12 SASI_Mm01_00267412 predicted 912
13 SASI_Mm01_00267413 predicted 1192
14 SASI_Mm01_00267414 predicted 1157
15 SASI_Mm01_00267415 predicted 1105
16 SASI_Mm01_00267417 predicted 743
17 SASI_Mm01_00267418 predicted 982
18 SASI_Mm01_00267419 predicted 1085
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_890360 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00230011 predicted 985
2 SASI_Mm01_00230012 predicted 443
3 SASI_Mm01_00230013 predicted 432
4 SASI_Mm01_00230014 predicted 581
5 SASI_Mm01_00230015 predicted 440
6 SASI_Mm01_00230016 predicted 615
7 SASI_Mm01_00230017 predicted 932
8 SASI_Mm01_00230018 predicted 361
9 SASI_Mm01_00230019 predicted 630
10 SASI_Mm01_00230020 predicted 986
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_898960 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00243716 predicted 988
2 SASI_Mm01_00243717 predicted 439
3 SASI_Mm01_00243718 predicted 433
4 SASI_Mm01_00243719 predicted 582
5 SASI_Mm01_00243720 predicted 616
6 SASI_Mm01_00243721 predicted 928
7 SASI_Mm01_00243722 predicted 1165
8 SASI_Mm01_00243723 predicted 1170
9 SASI_Mm01_00243724 predicted 1167
10 SASI_Mm01_00243725 predicted 355
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_906658 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00432657 predicted 977
2 SASI_Mm02_00432658 predicted 1032
3 SASI_Mm02_00432659 predicted 433
4 SASI_Mm02_00432660 predicted 425
5 SASI_Mm02_00432661 predicted 1908
6 SASI_Mm02_00432662 predicted 1026
7 SASI_Mm02_00432663 predicted 437
8 SASI_Mm02_00432664 predicted 1801
9 SASI_Mm02_00432665 predicted 352
10 SASI_Mm02_00432666 predicted 1814
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006073
TRDN MISSION shRNA Bacterial Glycerol Stock
triadin
Human
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000153458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006073.1-2269s1c1
Sequence:CCGGCCACAGTAGTTCAGGCAATTACTCGAGTAATTGCCTGAACTACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006073.1-1676s1c1
Sequence:CCGGGTTTCTCATGGTAAACCAGAACTCGAGTTCTGGTTTACCATGAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000150711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006073.1-2015s1c1
Sequence:CCGGCCAGCTTCAAAGAAAGCTAAACTCGAGTTTAGCTTTCTTTGAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006073.1-2227s1c1
Sequence:CCGGCCCTTACAAGTGCTTTAAGATCTCGAGATCTTAAAGCACTTGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000151564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006073.1-794s1c1
Sequence:CCGGGTGTCAAAGCATGAACAGAAACTCGAGTTTCTGTTCATGCTTTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006073.1-818s1c1
Sequence:CCGGCAGTATGCATTCTGTCGATATCTCGAGATATCGACAGAATGCATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006073.1-2380s1c1
Sequence:CCGGGCAGACATGTTTAAGGGTCTACTCGAGTAGACCCTTAAACATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152869    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006073.1-2737s1c1
Sequence:CCGGGCTTTGCTCTAAGAATGGGTACTCGAGTACCCATTCTTAGAGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006073.1-611s1c1
Sequence:CCGGGAAACAAAGACAGTGGCGAAACTCGAGTTTCGCCACTGTCTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006073.1-473s1c1
Sequence:CCGGCAAGAGAAACCTGAAAGGAAACTCGAGTTTCCTTTCAGGTTTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000152559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006073.1-1766s1c1
Sequence:CCGGGCTGAACATCGAGAAAGAGAACTCGAGTTCTCTTTCTCGATGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006073.1-206s1c1
Sequence:CCGGGCTGTTGCCATCGTTATGTTTCTCGAGAAACATAACGATGGCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000153306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006073.1-1040s1c1
Sequence:CCGGGAGAAGGAAACTGCCATTGATCTCGAGATCAATGGCAGTTTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006073
TRDN MISSION shRNA shRNA Plasmid DNA
triadin
Human
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000153458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006073.1-2269s1c1
Sequence:CCGGCCACAGTAGTTCAGGCAATTACTCGAGTAATTGCCTGAACTACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006073.1-1676s1c1
Sequence:CCGGGTTTCTCATGGTAAACCAGAACTCGAGTTCTGGTTTACCATGAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000150711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006073.1-2015s1c1
Sequence:CCGGCCAGCTTCAAAGAAAGCTAAACTCGAGTTTAGCTTTCTTTGAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006073.1-2227s1c1
Sequence:CCGGCCCTTACAAGTGCTTTAAGATCTCGAGATCTTAAAGCACTTGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000151564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006073.1-794s1c1
Sequence:CCGGGTGTCAAAGCATGAACAGAAACTCGAGTTTCTGTTCATGCTTTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006073.1-818s1c1
Sequence:CCGGCAGTATGCATTCTGTCGATATCTCGAGATATCGACAGAATGCATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006073.1-2380s1c1
Sequence:CCGGGCAGACATGTTTAAGGGTCTACTCGAGTAGACCCTTAAACATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152869    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006073.1-2737s1c1
Sequence:CCGGGCTTTGCTCTAAGAATGGGTACTCGAGTACCCATTCTTAGAGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006073.1-611s1c1
Sequence:CCGGGAAACAAAGACAGTGGCGAAACTCGAGTTTCGCCACTGTCTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006073.1-473s1c1
Sequence:CCGGCAAGAGAAACCTGAAAGGAAACTCGAGTTTCCTTTCAGGTTTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000152559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006073.1-1766s1c1
Sequence:CCGGGCTGAACATCGAGAAAGAGAACTCGAGTTCTCTTTCTCGATGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006073.1-206s1c1
Sequence:CCGGGCTGTTGCCATCGTTATGTTTCTCGAGAAACATAACGATGGCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000153306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006073.1-1040s1c1
Sequence:CCGGGAGAAGGAAACTGCCATTGATCTCGAGATCAATGGCAGTTTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006073
TRDN MISSION shRNA Lentiviral Transduction Particles
triadin
Human
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000153458    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006073.1-2269s1c1
Sequence:CCGGCCACAGTAGTTCAGGCAATTACTCGAGTAATTGCCTGAACTACTGTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150674    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006073.1-1676s1c1
Sequence:CCGGGTTTCTCATGGTAAACCAGAACTCGAGTTCTGGTTTACCATGAGAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000150711    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006073.1-2015s1c1
Sequence:CCGGCCAGCTTCAAAGAAAGCTAAACTCGAGTTTAGCTTTCTTTGAAGCTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006073.1-2227s1c1
Sequence:CCGGCCCTTACAAGTGCTTTAAGATCTCGAGATCTTAAAGCACTTGTAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000151564    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006073.1-794s1c1
Sequence:CCGGGTGTCAAAGCATGAACAGAAACTCGAGTTTCTGTTCATGCTTTGACACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152008    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006073.1-818s1c1
Sequence:CCGGCAGTATGCATTCTGTCGATATCTCGAGATATCGACAGAATGCATACTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153018    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006073.1-2380s1c1
Sequence:CCGGGCAGACATGTTTAAGGGTCTACTCGAGTAGACCCTTAAACATGTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152869    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_006073.1-2737s1c1
Sequence:CCGGGCTTTGCTCTAAGAATGGGTACTCGAGTACCCATTCTTAGAGCAAAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152762    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006073.1-611s1c1
Sequence:CCGGGAAACAAAGACAGTGGCGAAACTCGAGTTTCGCCACTGTCTTTGTTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152213    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006073.1-473s1c1
Sequence:CCGGCAAGAGAAACCTGAAAGGAAACTCGAGTTTCCTTTCAGGTTTCTCTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000152559    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006073.1-1766s1c1
Sequence:CCGGGCTGAACATCGAGAAAGAGAACTCGAGTTCTCTTTCTCGATGTTCAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153017    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006073.1-206s1c1
Sequence:CCGGGCTGTTGCCATCGTTATGTTTCTCGAGAAACATAACGATGGCAACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000153306    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_006073.1-1040s1c1
Sequence:CCGGGAGAAGGAAACTGCCATTGATCTCGAGATCAATGGCAGTTTCCTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_029726
TRDN MISSION shRNA Bacterial Glycerol Stock
triadin
Mouse
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000176411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029726.1-581s1c1
Sequence:CCGGGAAATAGAAGAACCTCCCTTACTCGAGTAAGGGAGGTTCTTCTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000175887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029726.1-734s1c1
Sequence:CCGGGCAACTCACAAAGAGAAACTTCTCGAGAAGTTTCTCTTTGTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029726.1-374s1c1
Sequence:CCGGGCTATCGTGATGTTTGATTTACTCGAGTAAATCAAACATCACGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000174633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029726.1-557s1c1
Sequence:CCGGGCAGATGAAGACATTGATAAACTCGAGTTTATCAATGTCTTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_029726
TRDN MISSION shRNA shRNA Plasmid DNA
triadin
Mouse
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000176411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029726.1-581s1c1
Sequence:CCGGGAAATAGAAGAACCTCCCTTACTCGAGTAAGGGAGGTTCTTCTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000175887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029726.1-734s1c1
Sequence:CCGGGCAACTCACAAAGAGAAACTTCTCGAGAAGTTTCTCTTTGTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029726.1-374s1c1
Sequence:CCGGGCTATCGTGATGTTTGATTTACTCGAGTAAATCAAACATCACGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000174633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029726.1-557s1c1
Sequence:CCGGGCAGATGAAGACATTGATAAACTCGAGTTTATCAATGTCTTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_029726
TRDN MISSION shRNA Lentiviral Transduction Particles
triadin
Mouse
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000176411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029726.1-581s1c1
Sequence:CCGGGAAATAGAAGAACCTCCCTTACTCGAGTAAGGGAGGTTCTTCTATTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000175887    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029726.1-734s1c1
Sequence:CCGGGCAACTCACAAAGAGAAACTTCTCGAGAAGTTTCTCTTTGTGAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174601    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029726.1-374s1c1
Sequence:CCGGGCTATCGTGATGTTTGATTTACTCGAGTAAATCAAACATCACGATAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000174633    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_029726.1-557s1c1
Sequence:CCGGGCAGATGAAGACATTGATAAACTCGAGTTTATCAATGTCTTCATCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks