EMAIL THIS PAGE TO A FRIEND

TREH

trehalase (brush-border membrane glycoprotein)

Synonyms: TRE TREA
UniProtKB ID: O43280, Q32MB9, Q53FY8
Gene ID:
Human(11181) Summary: This gene encodes an enzyme that hydrolyses trehalose, a disaccharide formed from two glucose molecules found mainly in fungi, plants, and insects. A partial duplication of this gene is located adjacent to this locus on chromosome 11. [provided by RefSeq, Jul 2008]
Mouse(58866) trehalase (brush-border membrane glycoprotein)
Rat(60576) trehalase (brush-border membrane glycoprotein)
fruit fly(45368) Trehalase
Zebrafish(795901) trehalase (brush-border membrane glycoprotein)
dog(489380) trehalase (brush-border membrane glycoprotein)
domestic cat(101083877) trehalase (brush-border membrane glycoprotein)
Horse(100071276) trehalase (brush-border membrane glycoprotein)
cow(522889) trehalase (brush-border membrane glycoprotein)
sheep(101103668) trehalase (brush-border membrane glycoprotein)
domestic guinea pig(100726401) trehalase (brush-border membrane glycoprotein)
Domestic Rabbit(100009126) trehalase (brush-border membrane glycoprotein)
naked mole-rat(101720126) trehalase (brush-border membrane glycoprotein)
64 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
D1542 1,4-Dideoxy-1,4-imino-D-arabinitol hydrochloride enzyme inhibitor human, mouse, rat pricing
M1777 N-Methyl-1-deoxynojirimycin ≥98% mouse, rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007180 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007180 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007180 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021481 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021481 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021481 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU026921 MISSION® esiRNA esiRNA human TREH (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007180 Rosetta Predictions human pricing
XM_001062931 Rosetta Predictions rat pricing
XM_343380 Rosetta Predictions rat pricing
NM_021481 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007180 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025568 predicted 757
2 SASI_Hs02_00343138 predicted 511
3 SASI_Hs01_00025569 predicted 395
4 SASI_Hs01_00025570 predicted 1570
5 SASI_Hs02_00343139 predicted 539
6 SASI_Hs01_00025571 predicted 1523
7 SASI_Hs01_00025572 predicted 1114
8 SASI_Hs01_00025573 predicted 1066
9 SASI_Hs01_00025574 predicted 721
10 SASI_Hs02_00343140 predicted 734
11 SASI_Hs01_00025567 predicted 1095
12 SASI_Hs01_00025575 predicted 1545
13 SASI_Hs01_00025576 predicted 766
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001062931 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00305159 predicted 1224
2 SASI_Rn02_00305160 predicted 1083
3 SASI_Rn02_00305161 predicted 1002
4 SASI_Rn02_00305162 predicted 687
5 SASI_Rn02_00305163 predicted 705
6 SASI_Rn02_00305164 predicted 1112
7 SASI_Rn02_00305165 predicted 1433
8 SASI_Rn02_00305166 predicted 357
9 SASI_Rn02_00305167 predicted 429
10 SASI_Rn02_00305168 predicted 621
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_343380 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00395704 predicted 456
2 SASI_Rn02_00395705 predicted 691
3 SASI_Rn02_00395706 predicted 592
4 SASI_Rn02_00395707 predicted 756
5 SASI_Rn02_00395708 predicted 706
6 SASI_Rn02_00395709 predicted 570
7 SASI_Rn02_00395710 predicted 357
8 SASI_Rn02_00395711 predicted 429
9 SASI_Rn02_00395712 predicted 349
10 SASI_Rn02_00395713 predicted 394
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021481 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00118852 predicted 1083
2 SASI_Mm01_00118853 predicted 1334
3 SASI_Mm01_00118854 predicted 1434
4 SASI_Mm01_00118855 predicted 1349
5 SASI_Mm01_00118857 predicted 690
6 SASI_Mm02_00326165 predicted 1286
7 SASI_Mm01_00118858 predicted 620
8 SASI_Mm01_00118859 predicted 820
9 SASI_Mm01_00118860 predicted 819
10 SASI_Mm01_00118861 predicted 270
11 SASI_Mm01_00118856 predicted 1550
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007180
TREH MISSION shRNA Bacterial Glycerol Stock
trehalase (brush-border membrane glycoprotein)
Human
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000183586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007180.1-880s1c1
Sequence:CCGGGAATCGCTATTATGTCCCTTACTCGAGTAAGGGACATAATAGCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000180037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007180.1-1387s1c1
Sequence:CCGGCCTGACTTACCAGTATGGGATCTCGAGATCCCATACTGGTAAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000149369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007180.1-1582s1c1
Sequence:CCGGGTCAGCCATGTATGAGAAGTACTCGAGTACTTCTCATACATGGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000148545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007180.1-1541s1c1
Sequence:CCGGCAGAATTGGATCCGAACCAATCTCGAGATTGGTTCGGATCCAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000147242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007180.1-1262s1c1
Sequence:CCGGGACCTTGAGAAGAAGAAGAAACTCGAGTTTCTTCTTCTTCTCAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007180.1-404s1c1
Sequence:CCGGCAGAAGATTTCAGATGCCAAACTCGAGTTTGGCATCTGAAATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000438051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007180.2-1366s21c1
Sequence:CCGGGACAACCGGATCCTGACTTACCTCGAGGTAAGTCAGGATCCGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000436954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007180.2-1076s21c1
Sequence:CCGGTGGTGCCTGTTGACCTGAATGCTCGAGCATTCAGGTCAACAGGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000425588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007180.2-122s21c1
Sequence:CCGGCACCCTGTGAGAGTGAGATTTCTCGAGAAATCTCACTCTCACAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007180.2-208s21c1
Sequence:CCGCGTGGACATGCCACTGTCTATACTCGAGTATAGACAGTGGCATGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007180.2-861s21c1
Sequence:CCGGCTACCTCCTGAATCGCTATTACTCGAGTAATAGCGATTCAGGAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000435380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007180.2-1634s21c1
Sequence:CCGGATGAAGTTCAGGAGGGATTTGCTCGAGCAAATCCCTCCTGAACTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007180
TREH MISSION shRNA shRNA Plasmid DNA
trehalase (brush-border membrane glycoprotein)
Human
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000183586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007180.1-880s1c1
Sequence:CCGGGAATCGCTATTATGTCCCTTACTCGAGTAAGGGACATAATAGCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000180037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007180.1-1387s1c1
Sequence:CCGGCCTGACTTACCAGTATGGGATCTCGAGATCCCATACTGGTAAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000149369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007180.1-1582s1c1
Sequence:CCGGGTCAGCCATGTATGAGAAGTACTCGAGTACTTCTCATACATGGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000148545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007180.1-1541s1c1
Sequence:CCGGCAGAATTGGATCCGAACCAATCTCGAGATTGGTTCGGATCCAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000147242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007180.1-1262s1c1
Sequence:CCGGGACCTTGAGAAGAAGAAGAAACTCGAGTTTCTTCTTCTTCTCAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007180.1-404s1c1
Sequence:CCGGCAGAAGATTTCAGATGCCAAACTCGAGTTTGGCATCTGAAATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000438051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007180.2-1366s21c1
Sequence:CCGGGACAACCGGATCCTGACTTACCTCGAGGTAAGTCAGGATCCGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000436954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007180.2-1076s21c1
Sequence:CCGGTGGTGCCTGTTGACCTGAATGCTCGAGCATTCAGGTCAACAGGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000425588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007180.2-122s21c1
Sequence:CCGGCACCCTGTGAGAGTGAGATTTCTCGAGAAATCTCACTCTCACAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007180.2-208s21c1
Sequence:CCGCGTGGACATGCCACTGTCTATACTCGAGTATAGACAGTGGCATGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007180.2-861s21c1
Sequence:CCGGCTACCTCCTGAATCGCTATTACTCGAGTAATAGCGATTCAGGAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000435380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007180.2-1634s21c1
Sequence:CCGGATGAAGTTCAGGAGGGATTTGCTCGAGCAAATCCCTCCTGAACTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007180
TREH MISSION shRNA Lentiviral Transduction Particles
trehalase (brush-border membrane glycoprotein)
Human
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000183586    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007180.1-880s1c1
Sequence:CCGGGAATCGCTATTATGTCCCTTACTCGAGTAAGGGACATAATAGCGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000180037    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_007180.1-1387s1c1
Sequence:CCGGCCTGACTTACCAGTATGGGATCTCGAGATCCCATACTGGTAAGTCAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000149369    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007180.1-1582s1c1
Sequence:CCGGGTCAGCCATGTATGAGAAGTACTCGAGTACTTCTCATACATGGCTGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000148545    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007180.1-1541s1c1
Sequence:CCGGCAGAATTGGATCCGAACCAATCTCGAGATTGGTTCGGATCCAATTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000147242    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007180.1-1262s1c1
Sequence:CCGGGACCTTGAGAAGAAGAAGAAACTCGAGTTTCTTCTTCTTCTCAAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007180.1-404s1c1
Sequence:CCGGCAGAAGATTTCAGATGCCAAACTCGAGTTTGGCATCTGAAATCTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000438051    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007180.2-1366s21c1
Sequence:CCGGGACAACCGGATCCTGACTTACCTCGAGGTAAGTCAGGATCCGGTTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000436954    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007180.2-1076s21c1
Sequence:CCGGTGGTGCCTGTTGACCTGAATGCTCGAGCATTCAGGTCAACAGGCACCATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000425588    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007180.2-122s21c1
Sequence:CCGGCACCCTGTGAGAGTGAGATTTCTCGAGAAATCTCACTCTCACAGGGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424382    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007180.2-208s21c1
Sequence:CCGCGTGGACATGCCACTGTCTATACTCGAGTATAGACAGTGGCATGTCCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417087    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007180.2-861s21c1
Sequence:CCGGCTACCTCCTGAATCGCTATTACTCGAGTAATAGCGATTCAGGAGGTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000435380    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007180.2-1634s21c1
Sequence:CCGGATGAAGTTCAGGAGGGATTTGCTCGAGCAAATCCCTCCTGAACTTCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021481
TREH MISSION shRNA Bacterial Glycerol Stock
trehalase (brush-border membrane glycoprotein)
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000126099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021481.1-1798s1c1
Sequence:CCGGCCCAGCTCATGGTTCATTAAACTCGAGTTTAATGAACCATGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021481.1-362s1c1
Sequence:CCGGGCAGAAGATCTCGGATGCTAACTCGAGTTAGCATCCGAGATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021481.1-1644s1c1
Sequence:CCGGCTGATGCTTCTGGATCGCTATCTCGAGATAGCGATCCAGAAGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021481.1-829s1c1
Sequence:CCGGGCTATGTCTTAAATCGCTACTCTCGAGAGTAGCGATTTAAGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000126101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021481.1-880s1c1
Sequence:CCGGCCTACAGGAAAGACGCAGAATCTCGAGATTCTGCGTCTTTCCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021481
TREH MISSION shRNA shRNA Plasmid DNA
trehalase (brush-border membrane glycoprotein)
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000126099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021481.1-1798s1c1
Sequence:CCGGCCCAGCTCATGGTTCATTAAACTCGAGTTTAATGAACCATGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021481.1-362s1c1
Sequence:CCGGGCAGAAGATCTCGGATGCTAACTCGAGTTAGCATCCGAGATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021481.1-1644s1c1
Sequence:CCGGCTGATGCTTCTGGATCGCTATCTCGAGATAGCGATCCAGAAGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021481.1-829s1c1
Sequence:CCGGGCTATGTCTTAAATCGCTACTCTCGAGAGTAGCGATTTAAGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000126101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021481.1-880s1c1
Sequence:CCGGCCTACAGGAAAGACGCAGAATCTCGAGATTCTGCGTCTTTCCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021481
TREH MISSION shRNA Lentiviral Transduction Particles
trehalase (brush-border membrane glycoprotein)
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000126099    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_021481.1-1798s1c1
Sequence:CCGGCCCAGCTCATGGTTCATTAAACTCGAGTTTAATGAACCATGAGCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021481.1-362s1c1
Sequence:CCGGGCAGAAGATCTCGGATGCTAACTCGAGTTAGCATCCGAGATCTTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021481.1-1644s1c1
Sequence:CCGGCTGATGCTTCTGGATCGCTATCTCGAGATAGCGATCCAGAAGCATCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021481.1-829s1c1
Sequence:CCGGGCTATGTCTTAAATCGCTACTCTCGAGAGTAGCGATTTAAGACATAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000126101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021481.1-880s1c1
Sequence:CCGGCCTACAGGAAAGACGCAGAATCTCGAGATTCTGCGTCTTTCCTGTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks