EMAIL THIS PAGE TO A FRIEND

TREM1

triggering receptor expressed on myeloid cells 1

Synonyms: CD354 TREM-1
UniProtKB ID: Q9NP99, B4DWG2, Q53FL8, Q5T2C9, Q86YU1
Gene ID:
Human(54210) Summary: This gene encodes a receptor belonging to the Ig superfamily that is expressed on myeloid cells. This protein amplifies neutrophil and monocyte-mediated inflammatory responses triggered by bacterial and fungal infections by stimulating release of pro-inflammatory chemokines and cytokines, as well as increased surface expression of cell activation markers. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene.[provided by RefSeq, Jun 2011]
Mouse(58217) triggering receptor expressed on myeloid cells 1
Rat(301229) triggering receptor expressed on myeloid cells 1
dog(608994) triggering receptor expressed on myeloid cells 1
domestic cat(101099551) triggering receptor expressed on myeloid cells 1
domestic guinea pig(101787849) triggering receptor expressed on myeloid cells 1
cow(404547) triggering receptor expressed on myeloid cells 1
sheep(101105695) triggering receptor expressed on myeloid cells 1
69 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_018643 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018643 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018643 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_021406 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_021406 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_021406 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU134461 MISSION® esiRNA esiRNA human TREM1 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018643 Rosetta Predictions human pricing
NM_001106885 Rosetta Predictions rat pricing
NM_021406 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00230990 predicted 425
2 SASI_Hs01_00230991 predicted 665
3 SASI_Hs01_00230992 predicted 369
4 SASI_Hs01_00230993 predicted 619
5 SASI_Hs01_00230994 predicted 578
6 SASI_Hs02_00352143 predicted 617
7 SASI_Hs01_00230995 predicted 366
8 SASI_Hs01_00230996 predicted 663
9 SASI_Hs01_00230997 predicted 213
10 SASI_Hs01_00230998 predicted 500
11 SASI_Hs01_00230989 predicted 622
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106885 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223366 predicted 272
2 SASI_Rn02_00223367 predicted 225
3 SASI_Rn02_00223368 predicted 269
4 SASI_Rn02_00223369 predicted 214
5 SASI_Rn02_00223370 predicted 401
6 SASI_Rn02_00223371 predicted 266
7 SASI_Rn02_00223372 predicted 313
8 SASI_Rn02_00223373 predicted 232
9 SASI_Rn02_00223374 predicted 265
10 SASI_Rn02_00223375 predicted 300
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021406 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00151841 predicted 298
2 SASI_Mm01_00151842 predicted 798
3 SASI_Mm01_00151843 predicted 271
4 SASI_Mm02_00326039 predicted 268
5 SASI_Mm01_00151844 predicted 287
6 SASI_Mm01_00151846 predicted 374
7 SASI_Mm01_00151847 predicted 623
8 SASI_Mm02_00326040 predicted 451
9 SASI_Mm01_00151848 predicted 362
10 SASI_Mm01_00151849 predicted 430
11 SASI_Mm01_00151845 predicted 347
12 SASI_Mm01_00151850 predicted 247
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018643
TREM1 MISSION shRNA Bacterial Glycerol Stock
triggering receptor expressed on myeloid cells 1
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018643.2-543s21c1
Sequence:CCGGAGGCCTTGTGCCCACTCTATACTCGAGTATAGAGTGGGCACAAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018643.2-165s21c1
Sequence:CCGGGGCAGACCCTGGATGTGAAATCTCGAGATTTCACATCCAGGGTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018643.2-117s21c1
Sequence:CCGGTCCGAGCTGCAACTAAATTAACTCGAGTTAATTTAGTTGCAGCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018643.2-365s1c1
Sequence:CCGGGTCAACCTTCAAGTGGAAGATCTCGAGATCTTCCACTTGAAGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018643.2-748s1c1
Sequence:CCGGGCTGAGGTCATTTGTACCCTACTCGAGTAGGGTACAAATGACCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018643.2-620s1c1
Sequence:CCGGCCTGACTCTGAAATCAACCTTCTCGAGAAGGTTGATTTCAGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018643.2-217s1c1
Sequence:CCGGCCAGAAAGCTTGGCAGATAATCTCGAGATTATCTGCCAAGCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018643.2-668s1c1
Sequence:CCGGCCGGTGTTCAACATTGTCATTCTCGAGAATGACAATGTTGAACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018643
TREM1 MISSION shRNA shRNA Plasmid DNA
triggering receptor expressed on myeloid cells 1
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018643.2-543s21c1
Sequence:CCGGAGGCCTTGTGCCCACTCTATACTCGAGTATAGAGTGGGCACAAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018643.2-165s21c1
Sequence:CCGGGGCAGACCCTGGATGTGAAATCTCGAGATTTCACATCCAGGGTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018643.2-117s21c1
Sequence:CCGGTCCGAGCTGCAACTAAATTAACTCGAGTTAATTTAGTTGCAGCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018643.2-365s1c1
Sequence:CCGGGTCAACCTTCAAGTGGAAGATCTCGAGATCTTCCACTTGAAGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018643.2-748s1c1
Sequence:CCGGGCTGAGGTCATTTGTACCCTACTCGAGTAGGGTACAAATGACCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018643.2-620s1c1
Sequence:CCGGCCTGACTCTGAAATCAACCTTCTCGAGAAGGTTGATTTCAGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018643.2-217s1c1
Sequence:CCGGCCAGAAAGCTTGGCAGATAATCTCGAGATTATCTGCCAAGCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018643.2-668s1c1
Sequence:CCGGCCGGTGTTCAACATTGTCATTCTCGAGAATGACAATGTTGAACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018643
TREM1 MISSION shRNA Lentiviral Transduction Particles
triggering receptor expressed on myeloid cells 1
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373807    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018643.2-543s21c1
Sequence:CCGGAGGCCTTGTGCCCACTCTATACTCGAGTATAGAGTGGGCACAAGGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373808    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018643.2-165s21c1
Sequence:CCGGGGCAGACCCTGGATGTGAAATCTCGAGATTTCACATCCAGGGTCTGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373809    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018643.2-117s21c1
Sequence:CCGGTCCGAGCTGCAACTAAATTAACTCGAGTTAATTTAGTTGCAGCTCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056757    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018643.2-365s1c1
Sequence:CCGGGTCAACCTTCAAGTGGAAGATCTCGAGATCTTCCACTTGAAGGTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056756    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018643.2-748s1c1
Sequence:CCGGGCTGAGGTCATTTGTACCCTACTCGAGTAGGGTACAAATGACCTCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056755    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018643.2-620s1c1
Sequence:CCGGCCTGACTCTGAAATCAACCTTCTCGAGAAGGTTGATTTCAGAGTCAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056754    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018643.2-217s1c1
Sequence:CCGGCCAGAAAGCTTGGCAGATAATCTCGAGATTATCTGCCAAGCTTTCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056753    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018643.2-668s1c1
Sequence:CCGGCCGGTGTTCAACATTGTCATTCTCGAGAATGACAATGTTGAACACCGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021406
TREM1 MISSION shRNA Bacterial Glycerol Stock
triggering receptor expressed on myeloid cells 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021406.2-149s1c1
Sequence:CCGGCCCTTCAACATCATGAAGTATCTCGAGATACTTCATGATGTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021406.2-83s1c1
Sequence:CCGGGCTGCCATTGTTCTAGAGGAACTCGAGTTCCTCTAGAACAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021406.2-427s1c1
Sequence:CCGGCAAGGGTTCTTCAGATGTGTTCTCGAGAACACATCTGAAGAACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021406.2-621s1c1
Sequence:CCGGCCACATCCAGTGTTACTATTTCTCGAGAAATAGTAACACTGGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021406.2-453s1c1
Sequence:CCGGCTGTCATCATTCCTATTACAACTCGAGTTGTAATAGGAATGATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021406
TREM1 MISSION shRNA shRNA Plasmid DNA
triggering receptor expressed on myeloid cells 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021406.2-149s1c1
Sequence:CCGGCCCTTCAACATCATGAAGTATCTCGAGATACTTCATGATGTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021406.2-83s1c1
Sequence:CCGGGCTGCCATTGTTCTAGAGGAACTCGAGTTCCTCTAGAACAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021406.2-427s1c1
Sequence:CCGGCAAGGGTTCTTCAGATGTGTTCTCGAGAACACATCTGAAGAACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021406.2-621s1c1
Sequence:CCGGCCACATCCAGTGTTACTATTTCTCGAGAAATAGTAACACTGGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021406.2-453s1c1
Sequence:CCGGCTGTCATCATTCCTATTACAACTCGAGTTGTAATAGGAATGATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021406
TREM1 MISSION shRNA Lentiviral Transduction Particles
triggering receptor expressed on myeloid cells 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068043    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021406.2-149s1c1
Sequence:CCGGCCCTTCAACATCATGAAGTATCTCGAGATACTTCATGATGTTGAAGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068045    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021406.2-83s1c1
Sequence:CCGGGCTGCCATTGTTCTAGAGGAACTCGAGTTCCTCTAGAACAATGGCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068046    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021406.2-427s1c1
Sequence:CCGGCAAGGGTTCTTCAGATGTGTTCTCGAGAACACATCTGAAGAACCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068044    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021406.2-621s1c1
Sequence:CCGGCCACATCCAGTGTTACTATTTCTCGAGAAATAGTAACACTGGATGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068047    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021406.2-453s1c1
Sequence:CCGGCTGTCATCATTCCTATTACAACTCGAGTTGTAATAGGAATGATGACAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks