EMAIL THIS PAGE TO A FRIEND

TREM2

triggering receptor expressed on myeloid cells 2

Synonyms: TREM-2 Trem2a Trem2b Trem2c
UniProtKB ID: Q9NZC2, Q8N5H8, Q8WYN6
Gene ID:
Human(54209) Summary: This gene encodes a membrane protein that forms a receptor signaling complex with the TYRO protein tyrosine kinase binding protein. The encoded protein functions in immune response and may be involved in chronic inflammation by triggering the production of constitutive inflammatory cytokines. Defects in this gene are a cause of polycystic lipomembranous osteodysplasia with sclerosing leukoencephalopathy (PLOSL). Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2012]
Mouse(83433) triggering receptor expressed on myeloid cells 2
Rat(301227) triggering receptor expressed on myeloid cells 2
cow(506467) triggering receptor expressed on myeloid cells 2
sheep(101105447) triggering receptor expressed on myeloid cells 2
domestic guinea pig(100720722) triggering receptor expressed on myeloid cells 2
naked mole-rat(101717064) triggering receptor expressed on myeloid cells 2
chicken(419920) triggering receptor expressed on myeloid cells 2
domestic cat(101099297) triggering receptor expressed on myeloid cells 2
dog(608965) triggering receptor expressed on myeloid cells 2
81 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_031254 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_031254 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_031254 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018965 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018965 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018965 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018965 Rosetta Predictions human pricing
NM_001106884 Rosetta Predictions rat pricing
NM_031254 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018965 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00352443 predicted 487
2 SASI_Hs01_00129548 predicted 270
3 SASI_Hs01_00129549 predicted 370
4 SASI_Hs01_00129550 predicted 370
5 SASI_Hs02_00352444 predicted 769
6 SASI_Hs02_00352445 predicted 362
7 SASI_Hs01_00129552 predicted 534
8 SASI_Hs01_00129554 predicted 282
9 SASI_Hs02_00352446 predicted 372
10 SASI_Hs02_00352447 predicted 772
11 SASI_Hs01_00129546 predicted 630
12 SASI_Hs01_00129547 predicted 704
13 SASI_Hs01_00129551 predicted 550
14 SASI_Hs01_00129553 predicted 752
15 SASI_Hs01_00129555 predicted 738
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001106884 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00223356 predicted 681
2 SASI_Rn02_00223357 predicted 654
3 SASI_Rn02_00223358 predicted 449
4 SASI_Rn02_00223359 predicted 479
5 SASI_Rn02_00223360 predicted 894
6 SASI_Rn02_00223361 predicted 701
7 SASI_Rn02_00223362 predicted 842
8 SASI_Rn02_00223363 predicted 274
9 SASI_Rn02_00223364 predicted 923
10 SASI_Rn02_00223365 predicted 457
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_031254 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00139097 predicted 691
2 SASI_Mm02_00337080 predicted 437
3 SASI_Mm01_00139098 predicted 796
4 SASI_Mm01_00139099 predicted 403
5 SASI_Mm01_00139100 predicted 604
6 SASI_Mm01_00139101 predicted 833
7 SASI_Mm01_00139103 predicted 552
8 SASI_Mm01_00139104 predicted 250
9 SASI_Mm01_00139105 predicted 862
10 SASI_Mm01_00139106 predicted 807
11 SASI_Mm01_00139102 predicted 763
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_031254
TREM2 MISSION shRNA Bacterial Glycerol Stock
triggering receptor expressed on myeloid cells 2
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000068093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031254.2-928s1c1
Sequence:CCGGCCAAGACTTCTGTTTCTGCTACTCGAGTAGCAGAAACAGAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031254.2-266s1c1
Sequence:CCGGGTCATGTACTTATGACGCCTTCTCGAGAAGGCGTCATAAGTACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031254.2-555s1c1
Sequence:CCGGGACCCTCTAGATGACCAAGATCTCGAGATCTTGGTCATCTAGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031254.2-428s1c1
Sequence:CCGGCCTTGCTGGAACCGTCACCATCTCGAGATGGTGACGGTTCCAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000068095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031254.2-696s1c1
Sequence:CCGGTGCGTTCTCCTGAGCAAGTTTCTCGAGAAACTTGCTCAGGAGAACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031254.2-800s21c1
Sequence:CCGGAGATGCTGGGCACCAACTTCACTCGAGTGAAGTTGGTGCCCAGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000412831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031254.2-636s21c1
Sequence:CCGGAGCACCTCCAGGAATCAAGAGCTCGAGCTCTTGATTCCTGGAGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031254.2-404s21c1
Sequence:CCGGGAGCACAGTCATCGCAGATGACTCGAGTCATCTGCGATGACTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_031254
TREM2 MISSION shRNA shRNA Plasmid DNA
triggering receptor expressed on myeloid cells 2
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000068093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031254.2-928s1c1
Sequence:CCGGCCAAGACTTCTGTTTCTGCTACTCGAGTAGCAGAAACAGAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031254.2-266s1c1
Sequence:CCGGGTCATGTACTTATGACGCCTTCTCGAGAAGGCGTCATAAGTACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031254.2-555s1c1
Sequence:CCGGGACCCTCTAGATGACCAAGATCTCGAGATCTTGGTCATCTAGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031254.2-428s1c1
Sequence:CCGGCCTTGCTGGAACCGTCACCATCTCGAGATGGTGACGGTTCCAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000068095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031254.2-696s1c1
Sequence:CCGGTGCGTTCTCCTGAGCAAGTTTCTCGAGAAACTTGCTCAGGAGAACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031254.2-800s21c1
Sequence:CCGGAGATGCTGGGCACCAACTTCACTCGAGTGAAGTTGGTGCCCAGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000412831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031254.2-636s21c1
Sequence:CCGGAGCACCTCCAGGAATCAAGAGCTCGAGCTCTTGATTCCTGGAGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031254.2-404s21c1
Sequence:CCGGGAGCACAGTCATCGCAGATGACTCGAGTCATCTGCGATGACTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_031254
TREM2 MISSION shRNA Lentiviral Transduction Particles
triggering receptor expressed on myeloid cells 2
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000068093    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_031254.2-928s1c1
Sequence:CCGGCCAAGACTTCTGTTTCTGCTACTCGAGTAGCAGAAACAGAAGTCTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068094    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031254.2-266s1c1
Sequence:CCGGGTCATGTACTTATGACGCCTTCTCGAGAAGGCGTCATAAGTACATGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068096    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031254.2-555s1c1
Sequence:CCGGGACCCTCTAGATGACCAAGATCTCGAGATCTTGGTCATCTAGAGGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068097    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031254.2-428s1c1
Sequence:CCGGCCTTGCTGGAACCGTCACCATCTCGAGATGGTGACGGTTCCAGCAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000068095    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_031254.2-696s1c1
Sequence:CCGGTGCGTTCTCCTGAGCAAGTTTCTCGAGAAACTTGCTCAGGAGAACGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428484    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031254.2-800s21c1
Sequence:CCGGAGATGCTGGGCACCAACTTCACTCGAGTGAAGTTGGTGCCCAGCATCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000412831    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031254.2-636s21c1
Sequence:CCGGAGCACCTCCAGGAATCAAGAGCTCGAGCTCTTGATTCCTGGAGGTGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_031254.2-404s21c1
Sequence:CCGGGAGCACAGTCATCGCAGATGACTCGAGTCATCTGCGATGACTGTGCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018965
TREM2 MISSION shRNA Bacterial Glycerol Stock
triggering receptor expressed on myeloid cells 2
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000056718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018965.1-371s1c1
Sequence:CCGGCTCACCATTACGCTGCGGAATCTCGAGATTCCGCAGCGTAATGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018965.1-277s1c1
Sequence:CCGGGCGTGTGGTCAGCACGCACAACTCGAGTTGTGCGTGCTGACCACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018965.1-741s1c1
Sequence:CCGGACCCAGGGTATCAGCTCCAAACTCGAGTTTGGAGCTGATACCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018965.1-145s1c1
Sequence:CCGGAGCCCACAACACCACAGTGTTCTCGAGAACACTGTGGTGTTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000056719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018965.1-577s1c1
Sequence:CCGGGAGCCTCTTGGAAGGAGAAATCTCGAGATTTCTCCTTCCAAGAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018965.2-787s21c1
Sequence:CCGGGACACGTGAAGGAAGATGATGCTCGAGCATCATCTTCCTTCACGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018965.2-639s21c1
Sequence:CCGGGGCCTGCATCTTTCTCATCAACTCGAGTTGATGAGAAAGATGCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018965.2-345s21c1
Sequence:CCGGCACAGCCATCACAGACGATACCTCGAGGTATCGTCTGTGATGGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018965
TREM2 MISSION shRNA shRNA Plasmid DNA
triggering receptor expressed on myeloid cells 2
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000056718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018965.1-371s1c1
Sequence:CCGGCTCACCATTACGCTGCGGAATCTCGAGATTCCGCAGCGTAATGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018965.1-277s1c1
Sequence:CCGGGCGTGTGGTCAGCACGCACAACTCGAGTTGTGCGTGCTGACCACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018965.1-741s1c1
Sequence:CCGGACCCAGGGTATCAGCTCCAAACTCGAGTTTGGAGCTGATACCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018965.1-145s1c1
Sequence:CCGGAGCCCACAACACCACAGTGTTCTCGAGAACACTGTGGTGTTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000056719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018965.1-577s1c1
Sequence:CCGGGAGCCTCTTGGAAGGAGAAATCTCGAGATTTCTCCTTCCAAGAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018965.2-787s21c1
Sequence:CCGGGACACGTGAAGGAAGATGATGCTCGAGCATCATCTTCCTTCACGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018965.2-639s21c1
Sequence:CCGGGGCCTGCATCTTTCTCATCAACTCGAGTTGATGAGAAAGATGCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018965.2-345s21c1
Sequence:CCGGCACAGCCATCACAGACGATACCTCGAGGTATCGTCTGTGATGGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018965
TREM2 MISSION shRNA Lentiviral Transduction Particles
triggering receptor expressed on myeloid cells 2
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000056718    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018965.1-371s1c1
Sequence:CCGGCTCACCATTACGCTGCGGAATCTCGAGATTCCGCAGCGTAATGGTGAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056722    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018965.1-277s1c1
Sequence:CCGGGCGTGTGGTCAGCACGCACAACTCGAGTTGTGCGTGCTGACCACACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056721    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018965.1-741s1c1
Sequence:CCGGACCCAGGGTATCAGCTCCAAACTCGAGTTTGGAGCTGATACCCTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056720    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018965.1-145s1c1
Sequence:CCGGAGCCCACAACACCACAGTGTTCTCGAGAACACTGTGGTGTTGTGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000056719    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018965.1-577s1c1
Sequence:CCGGGAGCCTCTTGGAAGGAGAAATCTCGAGATTTCTCCTTCCAAGAGGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373810    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018965.2-787s21c1
Sequence:CCGGGACACGTGAAGGAAGATGATGCTCGAGCATCATCTTCCTTCACGTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373731    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018965.2-639s21c1
Sequence:CCGGGGCCTGCATCTTTCTCATCAACTCGAGTTGATGAGAAAGATGCAGGCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373811    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_018965.2-345s21c1
Sequence:CCGGCACAGCCATCACAGACGATACCTCGAGGTATCGTCTGTGATGGCTGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks