EMAIL THIS PAGE TO A FRIEND

TREML1

triggering receptor expressed on myeloid cells-like 1

Synonyms: GLTL1825 PRO3438 TLT-1 TLT1 dJ238O23.3
UniProtKB ID: Q86YW5, Q496B3, Q8IWY1, Q8IWY2
Gene ID:
Human(340205) Summary: This gene encodes a member of the triggering receptor expressed on myeloid cells-like (TREM) family. The encoded protein is a type 1 single Ig domain orphan receptor localized to the alpha-granule membranes of platelets. The encoded protein is involved in platelet aggregation, inflammation, and cellular activation and has been linked to Gray platelet syndrome. Alternative splicing results in multiple transcript variants [provided by RefSeq, Nov 2012]
Mouse(71326) triggering receptor expressed on myeloid cells-like 1
Rat(501096) triggering receptor expressed on myeloid cells-like 1
cow(784711) triggering receptor expressed on myeloid cells-like 1
sheep(101105192) triggering receptor expressed on myeloid cells-like 1
domestic guinea pig(100720989) triggering receptor expressed on myeloid cells-like 1
naked mole-rat(101717411) triggering receptor expressed on myeloid cells-like 1
dog(474898) triggering receptor expressed on myeloid cells-like 1
domestic cat(101090357) triggering receptor expressed on myeloid cells-like 1
83 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

ELISA

Product # Description Species Add to Cart
 
RAB1864 Mouse TREML1 ELISA for serum, plasma and cell culture supernatants mouse pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_027763 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_027763 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_027763 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_178174 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_178174 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_178174 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_178174 Rosetta Predictions human pricing
XM_001063534 Rosetta Predictions rat pricing
XM_576511 Rosetta Predictions rat pricing
NM_027763 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_178174 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00093715 predicted 736
2 SASI_Hs01_00093716 predicted 426
3 SASI_Hs01_00093717 predicted 385
4 SASI_Hs01_00093718 predicted 743
5 SASI_Hs01_00093720 predicted 658
6 SASI_Hs02_00369588 predicted 612
7 SASI_Hs01_00093721 predicted 455
8 SASI_Hs01_00093722 predicted 339
9 SASI_Hs02_00369589 predicted 633
10 SASI_Hs01_00093723 predicted 420
11 SASI_Hs01_00093719 predicted 723
12 SASI_Hs01_00093724 predicted 547
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001063534 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00307462 predicted 562
2 SASI_Rn02_00307463 predicted 368
3 SASI_Rn02_00307464 predicted 574
4 SASI_Rn02_00307465 predicted 357
5 SASI_Rn02_00307466 predicted 202
6 SASI_Rn02_00307467 predicted 473
7 SASI_Rn02_00307468 predicted 567
8 SASI_Rn02_00307469 predicted 400
9 SASI_Rn02_00307470 predicted 596
10 SASI_Rn02_00307471 predicted 560
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_576511 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00405468 predicted 217
2 SASI_Rn02_00405469 predicted 280
3 SASI_Rn02_00405470 predicted 402
4 SASI_Rn02_00405471 predicted 218
5 SASI_Rn02_00405472 predicted 204
6 SASI_Rn02_00405473 predicted 216
7 SASI_Rn02_00405474 predicted 288
8 SASI_Rn02_00405475 predicted 403
9 SASI_Rn02_00405476 predicted 220
10 SASI_Rn02_00405477 predicted 336
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_027763 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00106212 predicted 962
2 SASI_Mm01_00106213 predicted 978
3 SASI_Mm01_00106214 predicted 760
4 SASI_Mm01_00106215 predicted 380
5 SASI_Mm01_00106216 predicted 522
6 SASI_Mm01_00106217 predicted 990
7 SASI_Mm01_00106218 predicted 426
8 SASI_Mm01_00106219 predicted 648
9 SASI_Mm01_00106220 predicted 940
10 SASI_Mm01_00106221 predicted 726
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_027763
TREML1 MISSION shRNA Bacterial Glycerol Stock
triggering receptor expressed on myeloid cells-like 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027763.1-1046s1c1
Sequence:CCGGCGGCCAACTAGCTCTGCCTTTCTCGAGAAAGGCAGAGCTAGTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027763.1-968s1c1
Sequence:CCGGGTCAAACTCCACCCAGTAAATCTCGAGATTTACTGGGTGGAGTTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027763.1-150s1c1
Sequence:CCGGCCAGGATGTGAGGGCTCTCAACTCGAGTTGAGAGCCCTCACATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027763.1-771s1c1
Sequence:CCGGGCCTTCCTTTGACTCTATCTACTCGAGTAGATAGAGTCAAAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027763.1-430s1c1
Sequence:CCGGGAGGACGAGAAAGAAACCTATCTCGAGATAGGTTTCTTTCTCGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_027763
TREML1 MISSION shRNA shRNA Plasmid DNA
triggering receptor expressed on myeloid cells-like 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027763.1-1046s1c1
Sequence:CCGGCGGCCAACTAGCTCTGCCTTTCTCGAGAAAGGCAGAGCTAGTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027763.1-968s1c1
Sequence:CCGGGTCAAACTCCACCCAGTAAATCTCGAGATTTACTGGGTGGAGTTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027763.1-150s1c1
Sequence:CCGGCCAGGATGTGAGGGCTCTCAACTCGAGTTGAGAGCCCTCACATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027763.1-771s1c1
Sequence:CCGGGCCTTCCTTTGACTCTATCTACTCGAGTAGATAGAGTCAAAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027763.1-430s1c1
Sequence:CCGGGAGGACGAGAAAGAAACCTATCTCGAGATAGGTTTCTTTCTCGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_027763
TREML1 MISSION shRNA Lentiviral Transduction Particles
triggering receptor expressed on myeloid cells-like 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100940    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_027763.1-1046s1c1
Sequence:CCGGCGGCCAACTAGCTCTGCCTTTCTCGAGAAAGGCAGAGCTAGTTGGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100943    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027763.1-968s1c1
Sequence:CCGGGTCAAACTCCACCCAGTAAATCTCGAGATTTACTGGGTGGAGTTTGACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100944    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027763.1-150s1c1
Sequence:CCGGCCAGGATGTGAGGGCTCTCAACTCGAGTTGAGAGCCCTCACATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100942    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027763.1-771s1c1
Sequence:CCGGGCCTTCCTTTGACTCTATCTACTCGAGTAGATAGAGTCAAAGGAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100941    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_027763.1-430s1c1
Sequence:CCGGGAGGACGAGAAAGAAACCTATCTCGAGATAGGTTTCTTTCTCGTCCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_178174
TREML1 MISSION shRNA Bacterial Glycerol Stock
triggering receptor expressed on myeloid cells-like 1
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178174.2-389s1c1
Sequence:CCGGGCACAGAGTCTCTCTGAACATCTCGAGATGTTCAGAGAGACTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178174.2-719s1c1
Sequence:CCGGGCCTTTGGATGTACCACACATCTCGAGATGTGTGGTACATCCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178174.2-170s1c1
Sequence:CCGGCCAGGATGTCAAAGCTCAGAACTCGAGTTCTGAGCTTTGACATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178174.2-647s1c1
Sequence:CCGGCAGCAGAGTTTCAGGCATGAACTCGAGTTCATGCCTGAAACTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000424271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178174.2-81s21c1
Sequence:CCGGCTAGAAGGTCAGGGCATAGTTCTCGAGAACTATGCCCTGACCTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000416263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178174.2-947s21c1
Sequence:CCGGGAATCCACCTAACAATCAGACCTCGAGGTCTGATTGTTAGGTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000423069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178174.2-450s21c1
Sequence:CCGGAGTCTGGCTGAGAACGCATTCCTCGAGGAATGCGTTCTCAGCCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_178174
TREML1 MISSION shRNA shRNA Plasmid DNA
triggering receptor expressed on myeloid cells-like 1
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178174.2-389s1c1
Sequence:CCGGGCACAGAGTCTCTCTGAACATCTCGAGATGTTCAGAGAGACTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178174.2-719s1c1
Sequence:CCGGGCCTTTGGATGTACCACACATCTCGAGATGTGTGGTACATCCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178174.2-170s1c1
Sequence:CCGGCCAGGATGTCAAAGCTCAGAACTCGAGTTCTGAGCTTTGACATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178174.2-647s1c1
Sequence:CCGGCAGCAGAGTTTCAGGCATGAACTCGAGTTCATGCCTGAAACTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000424271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178174.2-81s21c1
Sequence:CCGGCTAGAAGGTCAGGGCATAGTTCTCGAGAACTATGCCCTGACCTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000416263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178174.2-947s21c1
Sequence:CCGGGAATCCACCTAACAATCAGACCTCGAGGTCTGATTGTTAGGTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000423069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178174.2-450s21c1
Sequence:CCGGAGTCTGGCTGAGAACGCATTCCTCGAGGAATGCGTTCTCAGCCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_178174
TREML1 MISSION shRNA Lentiviral Transduction Particles
triggering receptor expressed on myeloid cells-like 1
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060350    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178174.2-389s1c1
Sequence:CCGGGCACAGAGTCTCTCTGAACATCTCGAGATGTTCAGAGAGACTCTGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060349    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178174.2-719s1c1
Sequence:CCGGGCCTTTGGATGTACCACACATCTCGAGATGTGTGGTACATCCAAAGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060348    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178174.2-170s1c1
Sequence:CCGGCCAGGATGTCAAAGCTCAGAACTCGAGTTCTGAGCTTTGACATCCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060352    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_178174.2-647s1c1
Sequence:CCGGCAGCAGAGTTTCAGGCATGAACTCGAGTTCATGCCTGAAACTCTGCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000424271    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178174.2-81s21c1
Sequence:CCGGCTAGAAGGTCAGGGCATAGTTCTCGAGAACTATGCCCTGACCTTCTAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000416263    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178174.2-947s21c1
Sequence:CCGGGAATCCACCTAACAATCAGACCTCGAGGTCTGATTGTTAGGTGGATTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000423069    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_178174.2-450s21c1
Sequence:CCGGAGTCTGGCTGAGAACGCATTCCTCGAGGAATGCGTTCTCAGCCAGACTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks