EMAIL THIS PAGE TO A FRIEND

TREML2

triggering receptor expressed on myeloid cells-like 2

Synonyms: C6orf76 TLT-2 TLT2 dJ238O23.1
UniProtKB ID: Q5T2D2, Q08AP8, Q08AP9, Q8IWY0, Q9H8E9
Gene ID:
Human(79865) Summary: TREML2 is located in a gene cluster on chromosome 6 with the single Ig variable (IgV) domain activating receptors TREM1 (MIM 605085) and TREM2 (MIM 605086), but it has distinct structural and functional properties (Allcock et al., 2003 [PubMed 12645956]
Mouse(328833) triggering receptor expressed on myeloid cells-like 2
Rat(680844) triggering receptor expressed on myeloid cells-like 2
chicken(768582) triggering receptor expressed on myeloid cells-like 2
dog(481791) triggering receptor expressed on myeloid cells-like 2
naked mole-rat(101716715) triggering receptor expressed on myeloid cells-like 2
domestic guinea pig(100720448) triggering receptor expressed on myeloid cells-like 2
cow(515548) triggering receptor expressed on myeloid cells-like 2
sheep(101108263) triggering receptor expressed on myeloid cells-like 2
63 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_024807 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_024807 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_024807 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_001033405 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_001033405 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_001033405 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU050871 MISSION® esiRNA esiRNA human TREML2 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_024807 Rosetta Predictions human pricing
XM_001059150 Rosetta Predictions rat pricing
NM_001033405 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_024807 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00016576 predicted 1111
2 SASI_Hs01_00016577 predicted 482
3 SASI_Hs02_00357350 predicted 728
4 SASI_Hs02_00357351 predicted 565
5 SASI_Hs01_00016578 predicted 689
6 SASI_Hs01_00016579 predicted 849
7 SASI_Hs01_00016580 predicted 738
8 SASI_Hs02_00357352 predicted 294
9 SASI_Hs01_00016582 predicted 235
10 SASI_Hs01_00016583 predicted 1592
11 SASI_Hs01_00016581 predicted 1068
12 SASI_Hs01_00016584 predicted 1083
13 SASI_Hs01_00016585 predicted 1551
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059150 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292162 predicted 241
2 SASI_Rn02_00292163 predicted 403
3 SASI_Rn02_00292164 predicted 442
4 SASI_Rn02_00292165 predicted 430
5 SASI_Rn02_00292166 predicted 316
6 SASI_Rn02_00292167 predicted 397
7 SASI_Rn02_00292168 predicted 278
8 SASI_Rn02_00292169 predicted 499
9 SASI_Rn02_00292170 predicted 479
10 SASI_Rn02_00292171 predicted 420
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033405 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00047896 predicted 800
2 SASI_Mm01_00047897 predicted 770
3 SASI_Mm01_00047898 predicted 980
4 SASI_Mm02_00288700 predicted 1362
5 SASI_Mm01_00047900 predicted 800
6 SASI_Mm02_00288701 predicted 1411
7 SASI_Mm02_00288702 predicted 1375
8 SASI_Mm01_00047901 predicted 982
9 SASI_Mm02_00288703 predicted 1403
10 SASI_Mm01_00047902 predicted 1252
11 SASI_Mm01_00047895 predicted 1898
12 SASI_Mm01_00047899 predicted 2036
13 SASI_Mm01_00047903 predicted 1212
14 SASI_Mm01_00047904 predicted 1107
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_024807
TREML2 MISSION shRNA Bacterial Glycerol Stock
triggering receptor expressed on myeloid cells-like 2
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000437714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024807.2-1071s21c1
Sequence:CCGGAGCATGTGCAGCGATCCTTCTCTCGAGAGAAGGATCGCTGCACATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024807.2-1217s21c1
Sequence:CCGGGGGCCAGTATCGATCTTATGACTCGAGTCATAAGATCGATACTGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024807.1-299s1c1
Sequence:CCGGTGCTCCTATAAGGGCTACAAACTCGAGTTTGTAGCCCTTATAGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024807.1-1117s1c1
Sequence:CCGGGCCCTATGTGGAAGTCTACTTCTCGAGAAGTAGACTTCCACATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024807.1-569s1c1
Sequence:CCGGAGGAACATTCCTTTCACACATCTCGAGATGTGTGAAAGGAATGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024807.1-38s1c1
Sequence:CCGGACACTGCCTAACTTCCCTAAACTCGAGTTTAGGGAAGTTAGGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024807.1-1015s1c1
Sequence:CCGGGCTGATGCTGATCATGGTCTACTCGAGTAGACCATGATCAGCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_024807
TREML2 MISSION shRNA shRNA Plasmid DNA
triggering receptor expressed on myeloid cells-like 2
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000437714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024807.2-1071s21c1
Sequence:CCGGAGCATGTGCAGCGATCCTTCTCTCGAGAGAAGGATCGCTGCACATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024807.2-1217s21c1
Sequence:CCGGGGGCCAGTATCGATCTTATGACTCGAGTCATAAGATCGATACTGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024807.1-299s1c1
Sequence:CCGGTGCTCCTATAAGGGCTACAAACTCGAGTTTGTAGCCCTTATAGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024807.1-1117s1c1
Sequence:CCGGGCCCTATGTGGAAGTCTACTTCTCGAGAAGTAGACTTCCACATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024807.1-569s1c1
Sequence:CCGGAGGAACATTCCTTTCACACATCTCGAGATGTGTGAAAGGAATGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024807.1-38s1c1
Sequence:CCGGACACTGCCTAACTTCCCTAAACTCGAGTTTAGGGAAGTTAGGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024807.1-1015s1c1
Sequence:CCGGGCTGATGCTGATCATGGTCTACTCGAGTAGACCATGATCAGCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_024807
TREML2 MISSION shRNA Lentiviral Transduction Particles
triggering receptor expressed on myeloid cells-like 2
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000437714    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_024807.2-1071s21c1
Sequence:CCGGAGCATGTGCAGCGATCCTTCTCTCGAGAGAAGGATCGCTGCACATGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430839    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_024807.2-1217s21c1
Sequence:CCGGGGGCCAGTATCGATCTTATGACTCGAGTCATAAGATCGATACTGGCCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060778    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024807.1-299s1c1
Sequence:CCGGTGCTCCTATAAGGGCTACAAACTCGAGTTTGTAGCCCTTATAGGAGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060781    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024807.1-1117s1c1
Sequence:CCGGGCCCTATGTGGAAGTCTACTTCTCGAGAAGTAGACTTCCACATAGGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060782    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024807.1-569s1c1
Sequence:CCGGAGGAACATTCCTTTCACACATCTCGAGATGTGTGAAAGGAATGTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060780    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024807.1-38s1c1
Sequence:CCGGACACTGCCTAACTTCCCTAAACTCGAGTTTAGGGAAGTTAGGCAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060779    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_024807.1-1015s1c1
Sequence:CCGGGCTGATGCTGATCATGGTCTACTCGAGTAGACCATGATCAGCATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_001033405
TREML2 MISSION shRNA Bacterial Glycerol Stock
triggering receptor expressed on myeloid cells-like 2
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000265184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033405.2-802s21c1
Sequence:CCGGTCCGGACGATACTGGTGTATGCTCGAGCATACACCAGTATCGTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033405.2-947s21c1
Sequence:CCGGCGACCGGCCAAGTCCATATTTCTCGAGAAATATGGACTTGGCCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033405.2-1390s21c1
Sequence:CCGGTTGGGCAGCAACTATGCTAAACTCGAGTTTAGCATAGTTGCTGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000251519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033405.2-4311s21c1
Sequence:CCGGTAGACCCAATGCCACTATAAACTCGAGTTTATAGTGGCATTGGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000265190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033405.2-985s21c1
Sequence:CCGGTTCACATCTGACGTGACTATGCTCGAGCATAGTCACGTCAGATGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_001033405
TREML2 MISSION shRNA shRNA Plasmid DNA
triggering receptor expressed on myeloid cells-like 2
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000265184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033405.2-802s21c1
Sequence:CCGGTCCGGACGATACTGGTGTATGCTCGAGCATACACCAGTATCGTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033405.2-947s21c1
Sequence:CCGGCGACCGGCCAAGTCCATATTTCTCGAGAAATATGGACTTGGCCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033405.2-1390s21c1
Sequence:CCGGTTGGGCAGCAACTATGCTAAACTCGAGTTTAGCATAGTTGCTGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000251519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033405.2-4311s21c1
Sequence:CCGGTAGACCCAATGCCACTATAAACTCGAGTTTATAGTGGCATTGGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000265190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033405.2-985s21c1
Sequence:CCGGTTCACATCTGACGTGACTATGCTCGAGCATAGTCACGTCAGATGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_001033405
TREML2 MISSION shRNA Lentiviral Transduction Particles
triggering receptor expressed on myeloid cells-like 2
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000265184    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033405.2-802s21c1
Sequence:CCGGTCCGGACGATACTGGTGTATGCTCGAGCATACACCAGTATCGTCCGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251517    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033405.2-947s21c1
Sequence:CCGGCGACCGGCCAAGTCCATATTTCTCGAGAAATATGGACTTGGCCGGTCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251518    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033405.2-1390s21c1
Sequence:CCGGTTGGGCAGCAACTATGCTAAACTCGAGTTTAGCATAGTTGCTGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000251519    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_001033405.2-4311s21c1
Sequence:CCGGTAGACCCAATGCCACTATAAACTCGAGTTTATAGTGGCATTGGGTCTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000265190    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_001033405.2-985s21c1
Sequence:CCGGTTCACATCTGACGTGACTATGCTCGAGCATAGTCACGTCAGATGTGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks