EMAIL THIS PAGE TO A FRIEND

TREML4

triggering receptor expressed on myeloid cells-like 4

Synonyms: TLT-4 TLT4
UniProtKB ID: Q6UXN2, B7ZL92
Gene ID:
Mouse(224840) triggering receptor expressed on myeloid cells-like 4
Rat(680862) triggering receptor expressed on myeloid cells-like 4
52 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_198153 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_198153 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_198153 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_172623 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172623 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172623 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU082351 MISSION® esiRNA esiRNA human TREML4 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_198153 Rosetta Predictions human pricing
XM_001059217 Rosetta Predictions rat pricing
NM_001033922 Rosetta Predictions mouse pricing
NM_172623 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_198153 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00210389 predicted 418
2 SASI_Hs01_00210390 predicted 400
3 SASI_Hs01_00210391 predicted 382
4 SASI_Hs01_00210392 predicted 407
5 SASI_Hs01_00210393 predicted 646
6 SASI_Hs01_00210394 predicted 417
7 SASI_Hs01_00210395 predicted 807
8 SASI_Hs01_00210398 predicted 434
9 SASI_Hs02_00371688 predicted 810
10 SASI_Hs01_00210396 predicted 535
11 SASI_Hs01_00210397 predicted 400
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_001059217 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00292464 predicted 273
2 SASI_Rn02_00292465 predicted 217
3 SASI_Rn02_00292466 predicted 497
4 SASI_Rn02_00292467 predicted 302
5 SASI_Rn02_00292468 predicted 479
6 SASI_Rn02_00292469 predicted 344
7 SASI_Rn02_00292470 predicted 274
8 SASI_Rn02_00292471 predicted 207
9 SASI_Rn02_00292472 predicted 263
10 SASI_Rn02_00292473 predicted 230
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001033922 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00050153 predicted 717
2 SASI_Mm01_00050154 predicted 713
3 SASI_Mm01_00050155 predicted 739
4 SASI_Mm01_00050156 predicted 535
5 SASI_Mm01_00050157 predicted 455
6 SASI_Mm01_00050158 predicted 757
7 SASI_Mm01_00050159 predicted 749
8 SASI_Mm01_00050160 predicted 547
9 SASI_Mm01_00050161 predicted 483
10 SASI_Mm02_00289040 predicted 535
11 SASI_Mm01_00050162 predicted 762
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172623 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00185156 predicted 772
2 SASI_Mm01_00185157 predicted 773
3 SASI_Mm01_00185158 predicted 800
4 SASI_Mm01_00185159 predicted 598
5 SASI_Mm01_00185160 predicted 518
6 SASI_Mm01_00185161 predicted 819
7 SASI_Mm01_00185162 predicted 810
8 SASI_Mm01_00185163 predicted 613
9 SASI_Mm01_00185164 predicted 542
10 SASI_Mm02_00344330 predicted 590
11 SASI_Mm01_00185165 predicted 820
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_198153
TREML4 MISSION shRNA Bacterial Glycerol Stock
triggering receptor expressed on myeloid cells-like 4
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000060678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198153.1-403s1c1
Sequence:CCGGTGACACAGAATGACTCGGGATCTCGAGATCCCGAGTCATTCTGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198153.1-177s1c1
Sequence:CCGGGTGCCTGAAGAACTTCACAAACTCGAGTTTGTGAAGTTCTTCAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198153.1-589s1c1
Sequence:CCGGCCTCCATCAATGGCTCTGAGACTCGAGTCTCAGAGCCATTGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198153.1-436s1c1
Sequence:CCGGGAATCTACAACGCTTCCGAAACTCGAGTTTCGGAAGCGTTGTAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000060679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198153.1-510s1c1
Sequence:CCGGACGTCTCCTATGTGGACTCTTCTCGAGAAGAGTCCACATAGGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198153.2-743s21c1
Sequence:CCGGGACAGCAGTGACGAGGTTTCTCTCGAGAGAAACCTCGTCACTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198153.2-1177s21c1
Sequence:CCGGGCCCTAGAGTCCTATGAATTTCTCGAGAAATTCATAGGACTCTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_198153
TREML4 MISSION shRNA shRNA Plasmid DNA
triggering receptor expressed on myeloid cells-like 4
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000060678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198153.1-403s1c1
Sequence:CCGGTGACACAGAATGACTCGGGATCTCGAGATCCCGAGTCATTCTGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198153.1-177s1c1
Sequence:CCGGGTGCCTGAAGAACTTCACAAACTCGAGTTTGTGAAGTTCTTCAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198153.1-589s1c1
Sequence:CCGGCCTCCATCAATGGCTCTGAGACTCGAGTCTCAGAGCCATTGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198153.1-436s1c1
Sequence:CCGGGAATCTACAACGCTTCCGAAACTCGAGTTTCGGAAGCGTTGTAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000060679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198153.1-510s1c1
Sequence:CCGGACGTCTCCTATGTGGACTCTTCTCGAGAAGAGTCCACATAGGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198153.2-743s21c1
Sequence:CCGGGACAGCAGTGACGAGGTTTCTCTCGAGAGAAACCTCGTCACTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198153.2-1177s21c1
Sequence:CCGGGCCCTAGAGTCCTATGAATTTCTCGAGAAATTCATAGGACTCTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_198153
TREML4 MISSION shRNA Lentiviral Transduction Particles
triggering receptor expressed on myeloid cells-like 4
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000060678    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198153.1-403s1c1
Sequence:CCGGTGACACAGAATGACTCGGGATCTCGAGATCCCGAGTCATTCTGTGTCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060680    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198153.1-177s1c1
Sequence:CCGGGTGCCTGAAGAACTTCACAAACTCGAGTTTGTGAAGTTCTTCAGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060682    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198153.1-589s1c1
Sequence:CCGGCCTCCATCAATGGCTCTGAGACTCGAGTCTCAGAGCCATTGATGGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060681    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198153.1-436s1c1
Sequence:CCGGGAATCTACAACGCTTCCGAAACTCGAGTTTCGGAAGCGTTGTAGATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000060679    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_198153.1-510s1c1
Sequence:CCGGACGTCTCCTATGTGGACTCTTCTCGAGAAGAGTCCACATAGGAGACGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437050    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198153.2-743s21c1
Sequence:CCGGGACAGCAGTGACGAGGTTTCTCTCGAGAGAAACCTCGTCACTGCTGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428703    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_198153.2-1177s21c1
Sequence:CCGGGCCCTAGAGTCCTATGAATTTCTCGAGAAATTCATAGGACTCTAGGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172623
TREML4 MISSION shRNA Bacterial Glycerol Stock
triggering receptor expressed on myeloid cells-like 4
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000100960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172623.1-1488s1c1
Sequence:CCGGGCTTATACAAAGAGGATGGTTCTCGAGAACCATCCTCTTTGTATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172623.1-220s1c1
Sequence:CCGGGCAGTGCCAATACAAGCCTAACTCGAGTTAGGCTTGTATTGGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172623.1-833s1c1
Sequence:CCGGGTTAGCCACATCTCAGGGTATCTCGAGATACCCTGAGATGTGGCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172623.1-334s1c1
Sequence:CCGGCAGGGAATTACAGCACACAATCTCGAGATTGTGTGCTGTAATTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000100963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172623.1-457s1c1
Sequence:CCGGAGAAGTAACTGTTCTCAGAAACTCGAGTTTCTGAGAACAGTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172623
TREML4 MISSION shRNA shRNA Plasmid DNA
triggering receptor expressed on myeloid cells-like 4
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000100960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172623.1-1488s1c1
Sequence:CCGGGCTTATACAAAGAGGATGGTTCTCGAGAACCATCCTCTTTGTATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172623.1-220s1c1
Sequence:CCGGGCAGTGCCAATACAAGCCTAACTCGAGTTAGGCTTGTATTGGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172623.1-833s1c1
Sequence:CCGGGTTAGCCACATCTCAGGGTATCTCGAGATACCCTGAGATGTGGCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172623.1-334s1c1
Sequence:CCGGCAGGGAATTACAGCACACAATCTCGAGATTGTGTGCTGTAATTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000100963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172623.1-457s1c1
Sequence:CCGGAGAAGTAACTGTTCTCAGAAACTCGAGTTTCTGAGAACAGTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172623
TREML4 MISSION shRNA Lentiviral Transduction Particles
triggering receptor expressed on myeloid cells-like 4
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000100960    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172623.1-1488s1c1
Sequence:CCGGGCTTATACAAAGAGGATGGTTCTCGAGAACCATCCTCTTTGTATAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100961    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172623.1-220s1c1
Sequence:CCGGGCAGTGCCAATACAAGCCTAACTCGAGTTAGGCTTGTATTGGCACTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100962    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172623.1-833s1c1
Sequence:CCGGGTTAGCCACATCTCAGGGTATCTCGAGATACCCTGAGATGTGGCTAACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100964    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172623.1-334s1c1
Sequence:CCGGCAGGGAATTACAGCACACAATCTCGAGATTGTGTGCTGTAATTCCCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000100963    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172623.1-457s1c1
Sequence:CCGGAGAAGTAACTGTTCTCAGAAACTCGAGTTTCTGAGAACAGTTACTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks