EMAIL THIS PAGE TO A FRIEND

TRERF1

transcriptional regulating factor 1

Synonyms: BCAR2 HSA277276 RAPA RP1-139D8.5 TREP132 TReP-132 dJ139D8.5
Gene ID:
Human(55809) Summary: This gene encodes a zinc-finger transcriptional regulating protein which interacts with CBP/p300 to regulate the human gene CYP11A1. [provided by RefSeq, Jul 2008]
Mouse(224829) transcriptional regulating factor 1
Rat(316219) transcriptional regulating factor 1
chicken(421386) transcriptional regulating factor 1
Horse(100054606) transcriptional regulating factor 1
domestic cat(101081298) transcriptional regulating factor 1
dog(608906) transcriptional regulating factor 1
domestic guinea pig(100714135) transcriptional regulating factor 1
naked mole-rat(101704325) transcriptional regulating factor 1
cow(504797) transcriptional regulating factor 1
sheep(101110370) transcriptional regulating factor 1
95 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_172622 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_172622 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_172622 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_018415 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_018415 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_018415 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_018415 Rosetta Predictions human pricing
NM_033501 Rosetta Predictions human pricing
NM_033502 Rosetta Predictions human pricing
NM_001108199 Rosetta Predictions rat pricing
NM_001097623 Rosetta Predictions mouse pricing
NM_172622 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_018415 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00018474 predicted 2642
2 SASI_Hs01_00018475 predicted 2499
3 SASI_Hs01_00018476 predicted 3432
4 SASI_Hs01_00018477 predicted 3463
5 SASI_Hs01_00018478 predicted 2620
6 SASI_Hs01_00018479 predicted 3644
7 SASI_Hs01_00018480 predicted 2414
8 SASI_Hs01_00018481 predicted 3575
9 SASI_Hs01_00018482 predicted 2433
10 SASI_Hs01_00018483 predicted 2735
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033501 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00013604 predicted 2638
2 SASI_Hs01_00013605 predicted 2504
3 SASI_Hs01_00013606 predicted 3387
4 SASI_Hs01_00013607 predicted 3424
5 SASI_Hs01_00013608 predicted 2619
6 SASI_Hs01_00013609 predicted 3616
7 SASI_Hs01_00013610 predicted 2409
8 SASI_Hs01_00013611 predicted 3535
9 SASI_Hs01_00013612 predicted 2426
10 SASI_Hs01_00013613 predicted 2737
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033502 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00142751 predicted 3101
2 SASI_Hs01_00142752 predicted 2968
3 SASI_Hs02_00361371 predicted 3743
4 SASI_Hs01_00142753 predicted 3860
5 SASI_Hs02_00361372 predicted 1020
6 SASI_Hs01_00142754 predicted 3895
7 SASI_Hs01_00142757 predicted 2876
8 SASI_Hs02_00361373 predicted 848
9 SASI_Hs01_00142758 predicted 4003
10 SASI_Hs01_00142759 predicted 2896
11 SASI_Hs01_00142755 predicted 3087
12 SASI_Hs01_00142756 predicted 4083
13 SASI_Hs01_00142760 predicted 3209
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108199 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00236294 predicted 735
2 SASI_Rn02_00236295 predicted 2568
3 SASI_Rn02_00236296 predicted 1766
4 SASI_Rn02_00236297 predicted 566
5 SASI_Rn02_00236298 predicted 694
6 SASI_Rn02_00236299 predicted 2941
7 SASI_Rn02_00236300 predicted 670
8 SASI_Rn02_00236301 predicted 2524
9 SASI_Rn02_00236302 predicted 636
10 SASI_Rn02_00236303 predicted 2366
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001097623 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00301186 predicted 3243
2 SASI_Mm02_00301187 predicted 926
3 SASI_Mm02_00301188 predicted 2068
4 SASI_Mm02_00301189 predicted 1035
5 SASI_Mm02_00301190 predicted 3738
6 SASI_Mm02_00301191 predicted 1947
7 SASI_Mm02_00301192 predicted 3205
8 SASI_Mm02_00301193 predicted 1063
9 SASI_Mm02_00301194 predicted 3193
10 SASI_Mm02_00301195 predicted 3039
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_172622 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00132552 predicted 3027
2 SASI_Mm01_00132553 predicted 762
3 SASI_Mm01_00132554 predicted 1908
4 SASI_Mm01_00132555 predicted 874
5 SASI_Mm01_00132556 predicted 3515
6 SASI_Mm01_00132557 predicted 1785
7 SASI_Mm01_00132558 predicted 2977
8 SASI_Mm01_00132559 predicted 902
9 SASI_Mm01_00132560 predicted 2964
10 SASI_Mm02_00344329 predicted 2816
11 SASI_Mm01_00132551 predicted 3172
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_172622
TRERF1 MISSION shRNA Bacterial Glycerol Stock
transcriptional regulating factor 1
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000095989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172622.1-3802s1c1
Sequence:CCGGGACTTCCTGCTCCTTTGGAAACTCGAGTTTCCAAAGGAGCAGGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172622.1-2470s1c1
Sequence:CCGGCCACGCATCAACATTGGCTTACTCGAGTAAGCCAATGTTGATGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172622.1-580s1c1
Sequence:CCGGCTGCGGATTCAGGTCAACAATCTCGAGATTGTTGACCTGAATCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172622.1-3165s1c1
Sequence:CCGGAGGCAACTTCATTTGTGAAATCTCGAGATTTCACAAATGAAGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000095993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172622.1-1098s1c1
Sequence:CCGGCCAACCCATGATGCAACACTTCTCGAGAAGTGTTGCATCATGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_172622
TRERF1 MISSION shRNA shRNA Plasmid DNA
transcriptional regulating factor 1
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000095989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172622.1-3802s1c1
Sequence:CCGGGACTTCCTGCTCCTTTGGAAACTCGAGTTTCCAAAGGAGCAGGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172622.1-2470s1c1
Sequence:CCGGCCACGCATCAACATTGGCTTACTCGAGTAAGCCAATGTTGATGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172622.1-580s1c1
Sequence:CCGGCTGCGGATTCAGGTCAACAATCTCGAGATTGTTGACCTGAATCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172622.1-3165s1c1
Sequence:CCGGAGGCAACTTCATTTGTGAAATCTCGAGATTTCACAAATGAAGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000095993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172622.1-1098s1c1
Sequence:CCGGCCAACCCATGATGCAACACTTCTCGAGAAGTGTTGCATCATGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_172622
TRERF1 MISSION shRNA Lentiviral Transduction Particles
transcriptional regulating factor 1
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000095989    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_172622.1-3802s1c1
Sequence:CCGGGACTTCCTGCTCCTTTGGAAACTCGAGTTTCCAAAGGAGCAGGAAGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095990    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172622.1-2470s1c1
Sequence:CCGGCCACGCATCAACATTGGCTTACTCGAGTAAGCCAATGTTGATGCGTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095991    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172622.1-580s1c1
Sequence:CCGGCTGCGGATTCAGGTCAACAATCTCGAGATTGTTGACCTGAATCCGCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095992    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172622.1-3165s1c1
Sequence:CCGGAGGCAACTTCATTTGTGAAATCTCGAGATTTCACAAATGAAGTTGCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000095993    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_172622.1-1098s1c1
Sequence:CCGGCCAACCCATGATGCAACACTTCTCGAGAAGTGTTGCATCATGGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_018415
TRERF1 MISSION shRNA Bacterial Glycerol Stock
transcriptional regulating factor 1
Human
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000047868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018415.1-2724s1c1
Sequence:CCGGCCTTTAGCAAATTACCACTATCTCGAGATAGTGGTAATTTGCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018415.1-1300s1c1
Sequence:CCGGCAATGCAGATACCTCAGTATTCTCGAGAATACTGAGGTATCTGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018415.1-2799s1c1
Sequence:CCGGGCCACTTACAGCAAAGACTTTCTCGAGAAAGTCTTTGCTGTAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018415.1-3460s1c1
Sequence:CCGGAGGAGGAACAACAGAGGCAAACTCGAGTTTGCCTCTGTTGTTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000047870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018415.1-2443s1c1
Sequence:CCGGGCTTGAGATTCCAAGCAGAAACTCGAGTTTCTGCTTGGAATCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_018415
TRERF1 MISSION shRNA shRNA Plasmid DNA
transcriptional regulating factor 1
Human
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000047868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018415.1-2724s1c1
Sequence:CCGGCCTTTAGCAAATTACCACTATCTCGAGATAGTGGTAATTTGCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018415.1-1300s1c1
Sequence:CCGGCAATGCAGATACCTCAGTATTCTCGAGAATACTGAGGTATCTGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018415.1-2799s1c1
Sequence:CCGGGCCACTTACAGCAAAGACTTTCTCGAGAAAGTCTTTGCTGTAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018415.1-3460s1c1
Sequence:CCGGAGGAGGAACAACAGAGGCAAACTCGAGTTTGCCTCTGTTGTTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000047870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018415.1-2443s1c1
Sequence:CCGGGCTTGAGATTCCAAGCAGAAACTCGAGTTTCTGCTTGGAATCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_018415
TRERF1 MISSION shRNA Lentiviral Transduction Particles
transcriptional regulating factor 1
Human
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000047868    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018415.1-2724s1c1
Sequence:CCGGCCTTTAGCAAATTACCACTATCTCGAGATAGTGGTAATTTGCTAAAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047869    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018415.1-1300s1c1
Sequence:CCGGCAATGCAGATACCTCAGTATTCTCGAGAATACTGAGGTATCTGCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047871    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018415.1-2799s1c1
Sequence:CCGGGCCACTTACAGCAAAGACTTTCTCGAGAAAGTCTTTGCTGTAAGTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047872    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018415.1-3460s1c1
Sequence:CCGGAGGAGGAACAACAGAGGCAAACTCGAGTTTGCCTCTGTTGTTCCTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000047870    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_018415.1-2443s1c1
Sequence:CCGGGCTTGAGATTCCAAGCAGAAACTCGAGTTTCTGCTTGGAATCTCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks