EMAIL THIS PAGE TO A FRIEND

TREX1

three prime repair exonuclease 1

Synonyms: AGS1 CRV DRN3 HERNS
UniProtKB ID: Q9NSU2, B2RCN9, Q8TEU2, Q9BPW1, Q9Y4X2
Gene ID:
Human(11277) Summary: This gene encodes a nuclear protein with 3' exonuclease activity. The encoded protein may play a role in DNA repair and serve as a proofreading function for DNA polymerase. Mutations in this gene result in Aicardi-Goutieres syndrome, chilblain lupus, Cree encephalitis, and other diseases of the immune system. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
Mouse(22040) three prime repair exonuclease 1
Rat(100049583) three prime repair exonuclease 1
dog(484778) three prime repair exonuclease 1
domestic cat(101098935) three prime repair exonuclease 1
cow(282099) three prime repair exonuclease 1
sheep(101119766) three prime repair exonuclease 1
naked mole-rat(101715376) three prime repair exonuclease 1
domestic guinea pig(100725870) three prime repair exonuclease 1
136 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_033629 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_033629 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_033629 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011637 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011637 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011637 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU031351 MISSION® esiRNA esiRNA targeting mouse Trex1 (esiRNA1) mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016381 Rosetta Predictions human pricing
NM_033627 Rosetta Predictions human pricing
NM_033628 Rosetta Predictions human pricing
NM_033629 Rosetta Predictions human pricing
NM_001024989 Rosetta Predictions rat pricing
NM_001012236 Rosetta Predictions mouse pricing
NM_011637 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00015998 predicted 1193
2 SASI_Hs01_00015999 predicted 1345
3 SASI_Hs01_00016000 predicted 1552
4 SASI_Hs01_00016001 predicted 1138
5 SASI_Hs01_00016002 predicted 1558
6 SASI_Hs01_00016003 predicted 1585
7 SASI_Hs01_00016004 predicted 1367
8 SASI_Hs01_00016005 predicted 1528
9 SASI_Hs01_00016006 predicted 1562
10 SASI_Hs02_00349377 predicted 1148
11 SASI_Hs01_00015997 predicted 1815
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033627 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00183652 predicted 3603
2 SASI_Hs01_00183653 predicted 3351
3 SASI_Hs01_00183654 predicted 3509
4 SASI_Hs01_00183655 predicted 3710
5 SASI_Hs01_00183656 predicted 3301
6 SASI_Hs01_00183657 predicted 3716
7 SASI_Hs01_00183658 predicted 3747
8 SASI_Hs01_00183659 predicted 3533
9 SASI_Hs01_00183660 predicted 3693
10 SASI_Hs01_00183661 predicted 3730
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033628 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00238655 predicted 3204
2 SASI_Hs01_00238656 predicted 2965
3 SASI_Hs01_00238657 predicted 3117
4 SASI_Hs01_00238658 predicted 3318
5 SASI_Hs01_00238659 predicted 2910
6 SASI_Hs01_00238660 predicted 3330
7 SASI_Hs01_00238661 predicted 3353
8 SASI_Hs01_00238662 predicted 3133
9 SASI_Hs01_00238663 predicted 3303
10 SASI_Hs01_00238664 predicted 3338
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_033629 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00160799 predicted 864
2 SASI_Hs01_00160800 predicted 1029
3 SASI_Hs01_00160801 predicted 1224
4 SASI_Hs01_00160802 predicted 813
5 SASI_Hs01_00160803 predicted 1229
6 SASI_Hs01_00160804 predicted 1260
7 SASI_Hs01_00160805 predicted 1045
8 SASI_Hs01_00160806 predicted 1208
9 SASI_Hs01_00160807 predicted 1244
10 SASI_Hs02_00361435 predicted 830
11 SASI_Hs01_00160798 predicted 1502
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001024989 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00202871 predicted 385
2 SASI_Rn02_00202872 predicted 467
3 SASI_Rn02_00202873 predicted 530
4 SASI_Rn02_00202874 predicted 602
5 SASI_Rn02_00202875 predicted 664
6 SASI_Rn02_00202876 predicted 435
7 SASI_Rn02_00202877 predicted 435
8 SASI_Rn02_00202878 predicted 263
9 SASI_Rn02_00202879 predicted 593
10 SASI_Rn02_00202880 predicted 225
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001012236 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00164886 predicted 571
2 SASI_Mm01_00164888 predicted 588
3 SASI_Mm01_00164889 predicted 437
4 SASI_Mm01_00164891 predicted 533
5 SASI_Mm01_00164894 predicted 604
6 SASI_Mm02_00287061 predicted 523
7 SASI_Mm01_00164885 predicted 640
8 SASI_Mm01_00164887 predicted 305
9 SASI_Mm02_00287062 predicted 416
10 SASI_Mm01_00164890 predicted 357
11 SASI_Mm01_00164892 predicted 644
12 SASI_Mm01_00164893 predicted 644
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011637 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00162291 predicted 585
2 SASI_Mm01_00162293 predicted 603
3 SASI_Mm01_00162294 predicted 444
4 SASI_Mm01_00162296 predicted 554
5 SASI_Mm01_00162299 predicted 622
6 SASI_Mm02_00321089 predicted 543
7 SASI_Mm01_00162290 predicted 654
8 SASI_Mm01_00162292 predicted 321
9 SASI_Mm02_00321090 predicted 436
10 SASI_Mm01_00162295 predicted 372
11 SASI_Mm01_00162297 predicted 662
12 SASI_Mm01_00162298 predicted 666
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_033629
VALIDATED
TREX1 MISSION shRNA Bacterial Glycerol Stock
three prime repair exonuclease 1
Human
11 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033629.1-1615s1c1
Sequence:CCGGCAAGACCATCTGCTGTCACAACTCGAGTTGTGACAGCAGATGGTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033629.1-1404s1c1
Sequence:CCGGCCAAGGAAGAGCTACAGCCTACTCGAGTAGGCTGTAGCTCTTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_033629.1-1697s1c1
Sequence:CCGGCAAGGATCTTCCTCCAGTGAACTCGAGTTCACTGGAGGAAGATCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033629.1-1428s1c1
Sequence:CCGGAGCATCTACACTCGCCTGTATCTCGAGATACAGGCGAGTGTAGATGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000011208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033629.1-956s1c1
Sequence:CCGGCTTGCCCTTCTCCCAGCCCAACTCGAGTTGGGCTGGGAGAAGGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033629.2-1267s21c1
Sequence:CCGGTGGCCACAACCAGGAACACTACTCGAGTAGTGTTCCTGGTTGTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033629.2-1047s21c1
Sequence:CCGGAGCATCTACACTCGCCTGTATCTCGAGATACAGGCGAGTGTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000369160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033629.2-534s21c1
Sequence:CCGGCCCATGCAGACCCTCATCTTTCTCGAGAAAGATGAGGGTCTGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033629.2-1316s21c1
Sequence:CCGGCAAGGATCTTCCTCCAGTGAACTCGAGTTCACTGGAGGAAGATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033629.2-878s21c1
Sequence:CCGGCAATGGTGACCGCTACGACTTCTCGAGAAGTCGTAGCGGTCACCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000315304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033629.2-965s21c1
Sequence:CCGGGGATAGCATCACTGCGCTGAACTCGAGTTCAGCGCAGTGATGCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_033629
VALIDATED
TREX1 MISSION shRNA shRNA Plasmid DNA
three prime repair exonuclease 1
Human
11 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033629.1-1615s1c1
Sequence:CCGGCAAGACCATCTGCTGTCACAACTCGAGTTGTGACAGCAGATGGTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033629.1-1404s1c1
Sequence:CCGGCCAAGGAAGAGCTACAGCCTACTCGAGTAGGCTGTAGCTCTTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_033629.1-1697s1c1
Sequence:CCGGCAAGGATCTTCCTCCAGTGAACTCGAGTTCACTGGAGGAAGATCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033629.1-1428s1c1
Sequence:CCGGAGCATCTACACTCGCCTGTATCTCGAGATACAGGCGAGTGTAGATGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000011208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033629.1-956s1c1
Sequence:CCGGCTTGCCCTTCTCCCAGCCCAACTCGAGTTGGGCTGGGAGAAGGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033629.2-1267s21c1
Sequence:CCGGTGGCCACAACCAGGAACACTACTCGAGTAGTGTTCCTGGTTGTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033629.2-1047s21c1
Sequence:CCGGAGCATCTACACTCGCCTGTATCTCGAGATACAGGCGAGTGTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000369160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033629.2-534s21c1
Sequence:CCGGCCCATGCAGACCCTCATCTTTCTCGAGAAAGATGAGGGTCTGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033629.2-1316s21c1
Sequence:CCGGCAAGGATCTTCCTCCAGTGAACTCGAGTTCACTGGAGGAAGATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033629.2-878s21c1
Sequence:CCGGCAATGGTGACCGCTACGACTTCTCGAGAAGTCGTAGCGGTCACCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000315304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033629.2-965s21c1
Sequence:CCGGGGATAGCATCACTGCGCTGAACTCGAGTTCAGCGCAGTGATGCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_033629
VALIDATED
TREX1 MISSION shRNA Lentiviral Transduction Particles
three prime repair exonuclease 1
Human
11 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007901    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033629.1-1615s1c1
Sequence:CCGGCAAGACCATCTGCTGTCACAACTCGAGTTGTGACAGCAGATGGTCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007902    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033629.1-1404s1c1
Sequence:CCGGCCAAGGAAGAGCTACAGCCTACTCGAGTAGGCTGTAGCTCTTCCTTGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011206    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: A549
TRC Version: 1 Clone ID:NM_033629.1-1697s1c1
Sequence:CCGGCAAGGATCTTCCTCCAGTGAACTCGAGTTCACTGGAGGAAGATCCTTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011207    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033629.1-1428s1c1
Sequence:CCGGAGCATCTACACTCGCCTGTATCTCGAGATACAGGCGAGTGTAGATGCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000011208    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_033629.1-956s1c1
Sequence:CCGGCTTGCCCTTCTCCCAGCCCAACTCGAGTTGGGCTGGGAGAAGGGCAAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369235    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033629.2-1267s21c1
Sequence:CCGGTGGCCACAACCAGGAACACTACTCGAGTAGTGTTCCTGGTTGTGGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315361    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033629.2-1047s21c1
Sequence:CCGGAGCATCTACACTCGCCTGTATCTCGAGATACAGGCGAGTGTAGATGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000369160    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033629.2-534s21c1
Sequence:CCGGCCCATGCAGACCCTCATCTTTCTCGAGAAAGATGAGGGTCTGCATGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315303    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033629.2-1316s21c1
Sequence:CCGGCAAGGATCTTCCTCCAGTGAACTCGAGTTCACTGGAGGAAGATCCTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315305    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033629.2-878s21c1
Sequence:CCGGCAATGGTGACCGCTACGACTTCTCGAGAAGTCGTAGCGGTCACCATTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000315304    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_033629.2-965s21c1
Sequence:CCGGGGATAGCATCACTGCGCTGAACTCGAGTTCAGCGCAGTGATGCTATCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011637
VALIDATED
TREX1 MISSION shRNA Bacterial Glycerol Stock
three prime repair exonuclease 1
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000077188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011637.6-111s1c1
Sequence:CCGGTCACATGCAGACCCTCATCTTCTCGAGAAGATGAGGGTCTGCATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011637.6-223s1c1
Sequence:CCGGACTTCCATTTCTCAGGGACATCTCGAGATGTCCCTGAGAAATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011637.6-805s1c1
Sequence:CCGGACAACCAACCTAAGGCCACATCTCGAGATGTGGCCTTAGGTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011637.6-522s1c1
Sequence:CCGGCCTAGATGGTACCTTCTGTGTCTCGAGACACAGAAGGTACCATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011637.6-667s1c1
Sequence:CCGGCATACTGCTGAAGGTGATGTTCTCGAGAACATCACCTTCAGCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011637.6-589s21c1
Sequence:CCGGTCAGGGAATGGTTCGAGGAAACTCGAGTTTCCTCGAACCATTCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011637.6-522s21c1
Sequence:CCGGCCTAGATGGTACCTTCTGTGTCTCGAGACACAGAAGGTACCATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000301227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011637.6-805s21c1
Sequence:CCGGACAACCAACCTAAGGCCACATCTCGAGATGTGGCCTTAGGTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011637.6-372s21c1
Sequence:CCGGGCGTCAACGCTTCGATGACAACTCGAGTTGTCATCGAAGCGTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000304257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011637.6-458s21c1
Sequence:CCGGACGGTGACCGCTATGACTTTCCTCGAGGAAAGTCATAGCGGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011637
VALIDATED
TREX1 MISSION shRNA shRNA Plasmid DNA
three prime repair exonuclease 1
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000077188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011637.6-111s1c1
Sequence:CCGGTCACATGCAGACCCTCATCTTCTCGAGAAGATGAGGGTCTGCATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011637.6-223s1c1
Sequence:CCGGACTTCCATTTCTCAGGGACATCTCGAGATGTCCCTGAGAAATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011637.6-805s1c1
Sequence:CCGGACAACCAACCTAAGGCCACATCTCGAGATGTGGCCTTAGGTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011637.6-522s1c1
Sequence:CCGGCCTAGATGGTACCTTCTGTGTCTCGAGACACAGAAGGTACCATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011637.6-667s1c1
Sequence:CCGGCATACTGCTGAAGGTGATGTTCTCGAGAACATCACCTTCAGCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011637.6-589s21c1
Sequence:CCGGTCAGGGAATGGTTCGAGGAAACTCGAGTTTCCTCGAACCATTCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011637.6-522s21c1
Sequence:CCGGCCTAGATGGTACCTTCTGTGTCTCGAGACACAGAAGGTACCATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000301227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011637.6-805s21c1
Sequence:CCGGACAACCAACCTAAGGCCACATCTCGAGATGTGGCCTTAGGTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011637.6-372s21c1
Sequence:CCGGGCGTCAACGCTTCGATGACAACTCGAGTTGTCATCGAAGCGTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000304257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011637.6-458s21c1
Sequence:CCGGACGGTGACCGCTATGACTTTCCTCGAGGAAAGTCATAGCGGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011637
VALIDATED
TREX1 MISSION shRNA Lentiviral Transduction Particles
three prime repair exonuclease 1
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000077188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011637.6-111s1c1
Sequence:CCGGTCACATGCAGACCCTCATCTTCTCGAGAAGATGAGGGTCTGCATGTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077190    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.52 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011637.6-223s1c1
Sequence:CCGGACTTCCATTTCTCAGGGACATCTCGAGATGTCCCTGAGAAATGGAAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077191    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011637.6-805s1c1
Sequence:CCGGACAACCAACCTAAGGCCACATCTCGAGATGTGGCCTTAGGTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077192    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.77 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011637.6-522s1c1
Sequence:CCGGCCTAGATGGTACCTTCTGTGTCTCGAGACACAGAAGGTACCATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077189    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.53 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_011637.6-667s1c1
Sequence:CCGGCATACTGCTGAAGGTGATGTTCTCGAGAACATCACCTTCAGCAGTATGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304258    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011637.6-589s21c1
Sequence:CCGGTCAGGGAATGGTTCGAGGAAACTCGAGTTTCCTCGAACCATTCCCTGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301226    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011637.6-522s21c1
Sequence:CCGGCCTAGATGGTACCTTCTGTGTCTCGAGACACAGAAGGTACCATCTAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000301227    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.5 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_011637.6-805s21c1
Sequence:CCGGACAACCAACCTAAGGCCACATCTCGAGATGTGGCCTTAGGTTGGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304256    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011637.6-372s21c1
Sequence:CCGGGCGTCAACGCTTCGATGACAACTCGAGTTGTCATCGAAGCGTTGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000304257    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011637.6-458s21c1
Sequence:CCGGACGGTGACCGCTATGACTTTCCTCGAGGAAAGTCATAGCGGTCACCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks