EMAIL THIS PAGE TO A FRIEND

TREX2

three prime repair exonuclease 2

UniProtKB ID: Q9BQ50, Q45F08, Q9UN77
Gene ID:
Human(11219) Summary: This gene encodes a nuclear protein with 3' to 5' exonuclease activity. The encoded protein participates in double-stranded DNA break repair, and may interact with DNA polymerase delta. [provided by RefSeq, Nov 2012]
Mouse(24102) three prime repair exonuclease 2
Rat(309275) three prime repair exonuclease 2
cow(614421) three prime repair exonuclease 2
sheep(101102374) three prime repair exonuclease 2
domestic guinea pig(100714260) three prime repair exonuclease 2
naked mole-rat(101712412) three prime repair exonuclease 2
dog(492236) three prime repair exonuclease 2
domestic cat(101086957) three prime repair exonuclease 2
46 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_080701 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080701 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080701 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011907 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011907 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011907 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_080700 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_080700 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_080700 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_080701 Rosetta Predictions human pricing
NM_001107580 Rosetta Predictions rat pricing
NM_011907 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_080701 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00025094 predicted 676
2 SASI_Hs01_00025096 predicted 679
3 SASI_Hs02_00362480 predicted 888
4 SASI_Hs01_00025097 predicted 882
5 SASI_Hs02_00362481 predicted 880
6 SASI_Hs01_00025098 predicted 554
7 SASI_Hs02_00362482 predicted 619
8 SASI_Hs01_00025100 predicted 552
9 SASI_Hs01_00025102 predicted 603
10 SASI_Hs01_00025103 predicted 619
11 SASI_Hs01_00025095 predicted 894
12 SASI_Hs01_00025099 predicted 893
13 SASI_Hs01_00025101 predicted 564
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001107580 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00230235 predicted 569
2 SASI_Rn02_00230236 predicted 756
3 SASI_Rn02_00230237 predicted 411
4 SASI_Rn02_00230238 predicted 397
5 SASI_Rn02_00230239 predicted 722
6 SASI_Rn02_00230240 predicted 389
7 SASI_Rn02_00230241 predicted 711
8 SASI_Rn02_00230242 predicted 564
9 SASI_Rn02_00230243 predicted 275
10 SASI_Rn02_00230244 predicted 602
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011907 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00032563 predicted 591
2 SASI_Mm01_00032564 predicted 297
3 SASI_Mm01_00032565 predicted 737
4 SASI_Mm01_00032566 predicted 585
5 SASI_Mm01_00032567 predicted 214
6 SASI_Mm02_00321729 predicted 203
7 SASI_Mm01_00032568 predicted 632
8 SASI_Mm01_00032569 predicted 785
9 SASI_Mm01_00032571 predicted 631
10 SASI_Mm01_00032572 predicted 435
11 SASI_Mm01_00032570 predicted 340
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080701
TREX2 MISSION shRNA Bacterial Glycerol Stock
three prime repair exonuclease 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000431678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080701.3-897s21c1
Sequence:CCGGATGGCTTTGATTATGATTTCCCTCGAGGGAAATCATAATCAAAGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000415200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080701.3-878s21c1
Sequence:CCGGATCTGCCTTGTGGCCCACAATCTCGAGATTGTGGGCCACAAGGCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000413874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080701.3-717s21c1
Sequence:CCGGACAAGCTCACGCTGTGCATGTCTCGAGACATGCACAGCGTGAGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000426635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080701.3-623s21c1
Sequence:CCGGATTGCCGAGCTGTCCCTCTTTCTCGAGAAAGAGGGACAGCTCGGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080701
TREX2 MISSION shRNA shRNA Plasmid DNA
three prime repair exonuclease 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000431678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080701.3-897s21c1
Sequence:CCGGATGGCTTTGATTATGATTTCCCTCGAGGGAAATCATAATCAAAGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000415200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080701.3-878s21c1
Sequence:CCGGATCTGCCTTGTGGCCCACAATCTCGAGATTGTGGGCCACAAGGCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000413874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080701.3-717s21c1
Sequence:CCGGACAAGCTCACGCTGTGCATGTCTCGAGACATGCACAGCGTGAGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000426635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080701.3-623s21c1
Sequence:CCGGATTGCCGAGCTGTCCCTCTTTCTCGAGAAAGAGGGACAGCTCGGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080701
TREX2 MISSION shRNA Lentiviral Transduction Particles
three prime repair exonuclease 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000431678    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080701.3-897s21c1
Sequence:CCGGATGGCTTTGATTATGATTTCCCTCGAGGGAAATCATAATCAAAGCCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000415200    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080701.3-878s21c1
Sequence:CCGGATCTGCCTTGTGGCCCACAATCTCGAGATTGTGGGCCACAAGGCAGATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000413874    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080701.3-717s21c1
Sequence:CCGGACAAGCTCACGCTGTGCATGTCTCGAGACATGCACAGCGTGAGCTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000426635    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_080701.3-623s21c1
Sequence:CCGGATTGCCGAGCTGTCCCTCTTTCTCGAGAAAGAGGGACAGCTCGGCAATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011907
TREX2 MISSION shRNA Bacterial Glycerol Stock
three prime repair exonuclease 2
Mouse
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000421559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011907.4-178s21c1
Sequence:CCGGTTTGCTGTTCACCGCTCTTCCCTCGAGGGAAGAGCGGTGAACAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000222734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011907.3-597s1c2
Sequence:CCGGCACCGCTACTTCCAGGCTGAACTCGAGTTCAGCCTGGAAGTAGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000428474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011907.4-793s21c1
Sequence:CCGGATGCCAGTGCCATCCATTCATCTCGAGATGAATGGATGGCACTGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011907.3-812s1c1
Sequence:CCGGGCTACATCTTTGCTCTCTGTACTCGAGTACAGAGAGCAAAGATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011907.3-129s1c1
Sequence:CCGGCCAAACATGGATCCTGAGATTCTCGAGAATCTCAGGATCCATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011907.3-190s1c1
Sequence:CCGGAGAACCCAGAACGGGATGATTCTCGAGAATCATCCCGTTCTGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000077196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011907.3-292s1c1
Sequence:CCGGGTGAGATTACTGGTTTGAGCACTCGAGTGCTCAAACCAGTAATCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011907
TREX2 MISSION shRNA shRNA Plasmid DNA
three prime repair exonuclease 2
Mouse
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000421559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011907.4-178s21c1
Sequence:CCGGTTTGCTGTTCACCGCTCTTCCCTCGAGGGAAGAGCGGTGAACAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000222734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011907.3-597s1c2
Sequence:CCGGCACCGCTACTTCCAGGCTGAACTCGAGTTCAGCCTGGAAGTAGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000428474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011907.4-793s21c1
Sequence:CCGGATGCCAGTGCCATCCATTCATCTCGAGATGAATGGATGGCACTGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011907.3-812s1c1
Sequence:CCGGGCTACATCTTTGCTCTCTGTACTCGAGTACAGAGAGCAAAGATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011907.3-129s1c1
Sequence:CCGGCCAAACATGGATCCTGAGATTCTCGAGAATCTCAGGATCCATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011907.3-190s1c1
Sequence:CCGGAGAACCCAGAACGGGATGATTCTCGAGAATCATCCCGTTCTGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000077196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011907.3-292s1c1
Sequence:CCGGGTGAGATTACTGGTTTGAGCACTCGAGTGCTCAAACCAGTAATCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011907
TREX2 MISSION shRNA Lentiviral Transduction Particles
three prime repair exonuclease 2
Mouse
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000421559    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_011907.4-178s21c1
Sequence:CCGGTTTGCTGTTCACCGCTCTTCCCTCGAGGGAAGAGCGGTGAACAGCAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000222734    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011907.3-597s1c2
Sequence:CCGGCACCGCTACTTCCAGGCTGAACTCGAGTTCAGCCTGGAAGTAGCGGTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000428474    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_011907.4-793s21c1
Sequence:CCGGATGCCAGTGCCATCCATTCATCTCGAGATGAATGGATGGCACTGGCATTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077193    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_011907.3-812s1c1
Sequence:CCGGGCTACATCTTTGCTCTCTGTACTCGAGTACAGAGAGCAAAGATGTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077194    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011907.3-129s1c1
Sequence:CCGGCCAAACATGGATCCTGAGATTCTCGAGAATCTCAGGATCCATGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077195    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011907.3-190s1c1
Sequence:CCGGAGAACCCAGAACGGGATGATTCTCGAGAATCATCCCGTTCTGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000077196    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011907.3-292s1c1
Sequence:CCGGGTGAGATTACTGGTTTGAGCACTCGAGTGCTCAAACCAGTAATCTCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_080700
TREX2 MISSION shRNA Bacterial Glycerol Stock
three prime repair exonuclease 2
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000007903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080700.1-1615s1c1
Sequence:CCGGTGGCCCACAATGGCTTTGATTCTCGAGAATCAAAGCCATTGTGGGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080700.1-1787s1c1
Sequence:CCGGCGGCAGCCTCTTCCACCGCTACTCGAGTAGCGGTGGAAGAGGCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080700.1-1232s1c1
Sequence:CCGGCTCTAGTTTGAGGACTTGCTACTCGAGTAGCAAGTCCTCAAACTAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080700.1-1189s1c1
Sequence:CCGGTGGATGATTGTGGCAGCAGAACTCGAGTTCTGCTGCCACAATCATCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_080700
TREX2 MISSION shRNA shRNA Plasmid DNA
three prime repair exonuclease 2
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000007903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080700.1-1615s1c1
Sequence:CCGGTGGCCCACAATGGCTTTGATTCTCGAGAATCAAAGCCATTGTGGGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080700.1-1787s1c1
Sequence:CCGGCGGCAGCCTCTTCCACCGCTACTCGAGTAGCGGTGGAAGAGGCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080700.1-1232s1c1
Sequence:CCGGCTCTAGTTTGAGGACTTGCTACTCGAGTAGCAAGTCCTCAAACTAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080700.1-1189s1c1
Sequence:CCGGTGGATGATTGTGGCAGCAGAACTCGAGTTCTGCTGCCACAATCATCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_080700
TREX2 MISSION shRNA Lentiviral Transduction Particles
three prime repair exonuclease 2
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000007903    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080700.1-1615s1c1
Sequence:CCGGTGGCCCACAATGGCTTTGATTCTCGAGAATCAAAGCCATTGTGGGCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007906    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080700.1-1787s1c1
Sequence:CCGGCGGCAGCCTCTTCCACCGCTACTCGAGTAGCGGTGGAAGAGGCTGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007904    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080700.1-1232s1c1
Sequence:CCGGCTCTAGTTTGAGGACTTGCTACTCGAGTAGCAAGTCCTCAAACTAGAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007905    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_080700.1-1189s1c1
Sequence:CCGGTGGATGATTGTGGCAGCAGAACTCGAGTTCTGCTGCCACAATCATCCATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks