EMAIL THIS PAGE TO A FRIEND

TRH

thyrotropin-releasing hormone

Synonyms: Pro-TRH TRF
UniProtKB ID: P20396, B2R8R1, Q2TB83
Gene ID:
Human(7200) Summary: This gene encodes a member of the thyrotropin-releasing hormone family. Cleavage of the encoded proprotein releases mature thyrotropin-releasing hormone, which is a tripeptide hypothalamic regulatory hormone. The human proprotein contains six thyrotropin-releasing hormone tripeptides. Thyrotropin-releasing hormone is involved in the regulation and release of thyroid-stimulating hormone, as well as prolactin. Deficiency of this hormone has been associated with hypothalamic hypothyroidism. [provided by RefSeq, May 2013]
Mouse(22044) thyrotropin releasing hormone
Rat(25569) thyrotropin releasing hormone
fruit fly(38065) trachealess
fruit fly(38121) Tryptophan hydroxylase
domestic cat(101099447) thyrotropin-releasing hormone
dog(484643) thyrotropin-releasing hormone
chicken(414344) thyrotropin-releasing hormone
Zebrafish(266721) thyrotropin-releasing hormone
cow(613414) thyrotropin-releasing hormone
sheep(101122470) thyrotropin-releasing hormone
domestic guinea pig(100717613) thyrotropin-releasing hormone
Domestic Rabbit(100303764) thyrotropin-releasing hormone
naked mole-rat(101698491) thyrotropin-releasing hormone
57 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
G5297 Glp-Asn-Pro-d-Tyr-d-Trp-NH2 ≥98% (HPLC), solid rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_007117 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_007117 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_007117 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_009426 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_009426 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_009426 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_007117 Rosetta Predictions human pricing
NM_013046 Rosetta Predictions rat pricing
NM_009426 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_007117 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00090883 predicted 855
2 SASI_Hs01_00090884 predicted 861
3 SASI_Hs01_00090885 predicted 853
4 SASI_Hs01_00090886 predicted 848
5 SASI_Hs01_00090887 predicted 848
6 SASI_Hs01_00090888 predicted 1313
7 SASI_Hs01_00090889 predicted 1330
8 SASI_Hs01_00090890 predicted 849
9 SASI_Hs01_00090891 predicted 472
10 SASI_Hs01_00090892 predicted 1268
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013046 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00115376 predicted 296
2 SASI_Rn01_00115377 predicted 899
3 SASI_Rn01_00115379 predicted 997
4 SASI_Rn01_00115380 predicted 434
5 SASI_Rn01_00115381 predicted 1035
6 SASI_Rn01_00115382 predicted 1016
7 SASI_Rn01_00115383 predicted 853
8 SASI_Rn01_00115384 predicted 893
9 SASI_Rn01_00115385 predicted 238
10 SASI_Rn02_00260772 predicted 931
11 SASI_Rn01_00115378 predicted 878
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_009426 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00316102 predicted 311
2 SASI_Mm02_00316103 predicted 310
3 SASI_Mm01_00135318 predicted 245
4 SASI_Mm01_00135320 predicted 888
5 SASI_Mm01_00135321 predicted 1049
6 SASI_Mm01_00135322 predicted 362
7 SASI_Mm01_00135324 predicted 363
8 SASI_Mm02_00316104 predicted 256
9 SASI_Mm02_00316105 predicted 904
10 SASI_Mm01_00135327 predicted 1004
11 SASI_Mm01_00135319 predicted 866
12 SASI_Mm01_00135323 predicted 962
13 SASI_Mm01_00135325 predicted 267
14 SASI_Mm01_00135326 predicted 270
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_007117
TRH MISSION shRNA Bacterial Glycerol Stock
thyrotropin-releasing hormone
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000373813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007117.2-1351s21c1
Sequence:CCGGACCATTCATGACCTCTGTATTCTCGAGAATACAGAGGTCATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007117.2-1091s21c1
Sequence:CCGGAGGAAGACCTGATGCCTGAAACTCGAGTTTCAGGCATCAGGTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007117.2-1034s21c1
Sequence:CCGGTGGCAGATCCCAAGGCTCAAACTCGAGTTTGAGCCTTGGGATCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000373816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007117.2-1375s21c1
Sequence:CCGGTAGTTAGATCCCTGACCATAACTCGAGTTATGGTCAGGGATCTAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007117.1-462s1c1
Sequence:CCGGGCCGACGAGAAGATGAGGCTTCTCGAGAAGCCTCATCTTCTCGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007117.1-541s1c1
Sequence:CCGGGCTTGCATATGCTGTCCCGAACTCGAGTTCGGGACAGCATATGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007117.1-327s1c1
Sequence:CCGGCCCAGATCTTTCAATCTGACTCTCGAGAGTCAGATTGAAAGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007117.1-490s1c1
Sequence:CCGGAGTCGATGTAACCCAGCACAACTCGAGTTGTGCTGGGTTACATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000083548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007117.1-1368s1c1
Sequence:CCGGGCTGTGTTACTGCTTGGAGAACTCGAGTTCTCCAAGCAGTAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_007117
TRH MISSION shRNA shRNA Plasmid DNA
thyrotropin-releasing hormone
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000373813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007117.2-1351s21c1
Sequence:CCGGACCATTCATGACCTCTGTATTCTCGAGAATACAGAGGTCATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007117.2-1091s21c1
Sequence:CCGGAGGAAGACCTGATGCCTGAAACTCGAGTTTCAGGCATCAGGTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007117.2-1034s21c1
Sequence:CCGGTGGCAGATCCCAAGGCTCAAACTCGAGTTTGAGCCTTGGGATCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000373816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007117.2-1375s21c1
Sequence:CCGGTAGTTAGATCCCTGACCATAACTCGAGTTATGGTCAGGGATCTAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007117.1-462s1c1
Sequence:CCGGGCCGACGAGAAGATGAGGCTTCTCGAGAAGCCTCATCTTCTCGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007117.1-541s1c1
Sequence:CCGGGCTTGCATATGCTGTCCCGAACTCGAGTTCGGGACAGCATATGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007117.1-327s1c1
Sequence:CCGGCCCAGATCTTTCAATCTGACTCTCGAGAGTCAGATTGAAAGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007117.1-490s1c1
Sequence:CCGGAGTCGATGTAACCCAGCACAACTCGAGTTGTGCTGGGTTACATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000083548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007117.1-1368s1c1
Sequence:CCGGGCTGTGTTACTGCTTGGAGAACTCGAGTTCTCCAAGCAGTAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_007117
TRH MISSION shRNA Lentiviral Transduction Particles
thyrotropin-releasing hormone
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000373813    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007117.2-1351s21c1
Sequence:CCGGACCATTCATGACCTCTGTATTCTCGAGAATACAGAGGTCATGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373732    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007117.2-1091s21c1
Sequence:CCGGAGGAAGACCTGATGCCTGAAACTCGAGTTTCAGGCATCAGGTCTTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373733    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_007117.2-1034s21c1
Sequence:CCGGTGGCAGATCCCAAGGCTCAAACTCGAGTTTGAGCCTTGGGATCTGCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000373816    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_007117.2-1375s21c1
Sequence:CCGGTAGTTAGATCCCTGACCATAACTCGAGTTATGGTCAGGGATCTAACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083552    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007117.1-462s1c1
Sequence:CCGGGCCGACGAGAAGATGAGGCTTCTCGAGAAGCCTCATCTTCTCGTCGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083551    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007117.1-541s1c1
Sequence:CCGGGCTTGCATATGCTGTCCCGAACTCGAGTTCGGGACAGCATATGCAAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083550    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007117.1-327s1c1
Sequence:CCGGCCCAGATCTTTCAATCTGACTCTCGAGAGTCAGATTGAAAGATCTGGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083549    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_007117.1-490s1c1
Sequence:CCGGAGTCGATGTAACCCAGCACAACTCGAGTTGTGCTGGGTTACATCGACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000083548    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_007117.1-1368s1c1
Sequence:CCGGGCTGTGTTACTGCTTGGAGAACTCGAGTTCTCCAAGCAGTAACACAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_009426
TRH MISSION shRNA Bacterial Glycerol Stock
thyrotropin-releasing hormone
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000089088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009426.1-858s1c1
Sequence:CCGGGCTGATGTAAGCCCTGTGTATCTCGAGATACACAGGGCTTACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009426.1-594s1c1
Sequence:CCGGTCATAGATCCTGAGCTCCAAACTCGAGTTTGGAGCTCAGGATCTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009426.1-89s1c1
Sequence:CCGGCTGGCTTTGATCTTCGTGCTACTCGAGTAGCACGAAGATCAAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009426.1-405s1c1
Sequence:CCGGCCAACCAAGACAAGGATTCATCTCGAGATGAATCCTTGTCTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000089090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009426.1-209s1c1
Sequence:CCGGGAACGTCGATTCTTGAGGAAACTCGAGTTTCCTCAAGAATCGACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_009426
TRH MISSION shRNA shRNA Plasmid DNA
thyrotropin-releasing hormone
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000089088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009426.1-858s1c1
Sequence:CCGGGCTGATGTAAGCCCTGTGTATCTCGAGATACACAGGGCTTACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009426.1-594s1c1
Sequence:CCGGTCATAGATCCTGAGCTCCAAACTCGAGTTTGGAGCTCAGGATCTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009426.1-89s1c1
Sequence:CCGGCTGGCTTTGATCTTCGTGCTACTCGAGTAGCACGAAGATCAAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009426.1-405s1c1
Sequence:CCGGCCAACCAAGACAAGGATTCATCTCGAGATGAATCCTTGTCTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000089090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009426.1-209s1c1
Sequence:CCGGGAACGTCGATTCTTGAGGAAACTCGAGTTTCCTCAAGAATCGACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_009426
TRH MISSION shRNA Lentiviral Transduction Particles
thyrotropin-releasing hormone
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000089088    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_009426.1-858s1c1
Sequence:CCGGGCTGATGTAAGCCCTGTGTATCTCGAGATACACAGGGCTTACATCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089092    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009426.1-594s1c1
Sequence:CCGGTCATAGATCCTGAGCTCCAAACTCGAGTTTGGAGCTCAGGATCTATGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089091    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009426.1-89s1c1
Sequence:CCGGCTGGCTTTGATCTTCGTGCTACTCGAGTAGCACGAAGATCAAAGCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089089    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009426.1-405s1c1
Sequence:CCGGCCAACCAAGACAAGGATTCATCTCGAGATGAATCCTTGTCTTGGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000089090    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_009426.1-209s1c1
Sequence:CCGGGAACGTCGATTCTTGAGGAAACTCGAGTTTCCTCAAGAATCGACGTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks