EMAIL THIS PAGE TO A FRIEND

TRHDE-AS1

TRHDE antisense RNA 1

Species: Human TRHDE-AS1(283392)
Gene ID:
40 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-XM_378368 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-XM_378368 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-XM_378368 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_001025457 Rosetta Predictions human pricing
XR_039893 Rosetta Predictions human pricing
XR_039894 Rosetta Predictions human pricing
XR_039895 Rosetta Predictions human pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001025457 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00119815 predicted 275
2 SASI_Hs01_00119816 predicted 349
3 SASI_Hs01_00119817 predicted 226
4 SASI_Hs01_00119818 predicted 180
5 SASI_Hs01_00119819 predicted 243
6 SASI_Hs01_00119820 predicted 227
7 SASI_Hs01_00119821 predicted 278
8 SASI_Hs01_00119822 predicted 224
9 SASI_Hs01_00119823 predicted 240
10 SASI_Hs01_00119824 predicted 282
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039893 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00513993 predicted 1334
2 SASI_Hs02_00513994 predicted 1652
3 SASI_Hs02_00513995 predicted 1387
4 SASI_Hs02_00513996 predicted 1171
5 SASI_Hs02_00513997 predicted 533
6 SASI_Hs02_00513998 predicted 1965
7 SASI_Hs02_00513999 predicted 1705
8 SASI_Hs02_00514000 predicted 2649
9 SASI_Hs02_00514001 predicted 226
10 SASI_Hs02_00514002 predicted 1981
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039894 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514003 predicted 1332
2 SASI_Hs02_00514004 predicted 1646
3 SASI_Hs02_00514005 predicted 1390
4 SASI_Hs02_00514006 predicted 1170
5 SASI_Hs02_00514007 predicted 529
6 SASI_Hs02_00514008 predicted 1700
7 SASI_Hs02_00514009 predicted 2647
8 SASI_Hs02_00514010 predicted 2860
9 SASI_Hs02_00514011 predicted 228
10 SASI_Hs02_00514012 predicted 1986
siRNA
PRODUCT # siRNA Type ? SPECIES
XR_039895 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs02_00514013 predicted 1655
2 SASI_Hs02_00514014 predicted 1388
3 SASI_Hs02_00514015 predicted 1176
4 SASI_Hs02_00514016 predicted 529
5 SASI_Hs02_00514017 predicted 1967
6 SASI_Hs02_00514018 predicted 1699
7 SASI_Hs02_00514019 predicted 2635
8 SASI_Hs02_00514020 predicted 2846
9 SASI_Hs02_00514021 predicted 224
10 SASI_Hs02_00514022 predicted 1983
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-XM_378368
TRHDE-AS1 MISSION shRNA Bacterial Glycerol Stock
TRHDE antisense RNA 1
Human
4 Products Total
TRC Number Price Set Price (4)? Select
TRCN0000204407    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_378368.1-655s1c1
Sequence:CCGGCCGGAGATGACAAGTGAGAAACTCGAGTTTCTCACTTGTCATCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000187105    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_378368.1-2289s1c1
Sequence:CCGGCCCTGTAAAGTTGAAGAAGTACTCGAGTACTTCTTCAACTTTACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000184984    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_378368.1-1285s1c1
Sequence:CCGGCGCAATTTATTAAGATGGCAACTCGAGTTGCCATCTTAATAAATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000186165    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_378368.1-697s1c1
Sequence:CCGGCCCTTCAGTTACCAAGAATAACTCGAGTTATTCTTGGTAACTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-XM_378368
TRHDE-AS1 MISSION shRNA shRNA Plasmid DNA
TRHDE antisense RNA 1
Human
4 Products Total
TRC Number Vector Price Set Price (4)? Select
TRCN0000204407    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_378368.1-655s1c1
Sequence:CCGGCCGGAGATGACAAGTGAGAAACTCGAGTTTCTCACTTGTCATCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000187105    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_378368.1-2289s1c1
Sequence:CCGGCCCTGTAAAGTTGAAGAAGTACTCGAGTACTTCTTCAACTTTACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000184984    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_378368.1-1285s1c1
Sequence:CCGGCGCAATTTATTAAGATGGCAACTCGAGTTGCCATCTTAATAAATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000186165    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_378368.1-697s1c1
Sequence:CCGGCCCTTCAGTTACCAAGAATAACTCGAGTTATTCTTGGTAACTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-XM_378368
TRHDE-AS1 MISSION shRNA Lentiviral Transduction Particles
TRHDE antisense RNA 1
Human
4 Products Total
TRC Number Volume Titer Vector Price Set Price (4)? Select
TRCN0000204407    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_378368.1-655s1c1
Sequence:CCGGCCGGAGATGACAAGTGAGAAACTCGAGTTTCTCACTTGTCATCTCCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000187105    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_378368.1-2289s1c1
Sequence:CCGGCCCTGTAAAGTTGAAGAAGTACTCGAGTACTTCTTCAACTTTACAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000184984    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_378368.1-1285s1c1
Sequence:CCGGCGCAATTTATTAAGATGGCAACTCGAGTTGCCATCTTAATAAATTGCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000186165    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:XM_378368.1-697s1c1
Sequence:CCGGCCCTTCAGTTACCAAGAATAACTCGAGTTATTCTTGGTAACTGAAGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks