EMAIL THIS PAGE TO A FRIEND

TRHDE

thyrotropin-releasing hormone degrading enzyme

Synonyms: PAP-II PGPEP2 TRH-DE
UniProtKB ID: Q9UKU6, A5PL19, Q6UWJ4
Gene ID:
Human(29953) Summary: This gene encodes a member of the peptidase M1 family. The encoded protein is an extracellular peptidase that specifically cleaves and inactivates the neuropeptide thyrotropin-releasing hormone.[provided by RefSeq, Dec 2008]
Mouse(237553) TRH-degrading enzyme
Rat(366894) thyrotropin-releasing hormone degrading enzyme
chicken(427868) thyrotropin-releasing hormone degrading enzyme
domestic cat(101085556) thyrotropin-releasing hormone degrading enzyme
Horse(100057250) thyrotropin-releasing hormone degrading enzyme
dog(481166) thyrotropin-releasing hormone degrading enzyme
naked mole-rat(101714026) thyrotropin-releasing hormone degrading enzyme
Domestic Rabbit(100352490) thyrotropin-releasing hormone degrading enzyme
domestic guinea pig(100717767) thyrotropin-releasing hormone degrading enzyme
cow(100336818) thyrotropin-releasing hormone degrading enzyme
sheep(100310794) thyrotropin-releasing hormone degrading enzyme
170 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1301723 ANTI-TRHDE (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution human
flow cytometry, western blot pricing

Small Molecule - Inhibitor

Product # Description Species Add to Cart
 
G5297 Glp-Asn-Pro-d-Tyr-d-Trp-NH2 ≥98% (HPLC), solid rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013381 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_013381 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_013381 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_146241 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_146241 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_146241 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_013381 Rosetta Predictions human pricing
NM_001108991 Rosetta Predictions rat pricing
NM_146241 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013381 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00229427 predicted 2188
2 SASI_Hs01_00229428 predicted 2944
3 SASI_Hs02_00344735 predicted 2950
4 SASI_Hs01_00229429 predicted 931
5 SASI_Hs02_00344736 predicted 2293
6 SASI_Hs01_00229431 predicted 2634
7 SASI_Hs01_00229432 predicted 2084
8 SASI_Hs01_00229433 predicted 2597
9 SASI_Hs01_00229434 predicted 1648
10 SASI_Hs01_00229436 predicted 1194
11 SASI_Hs01_00229430 predicted 2992
12 SASI_Hs01_00229435 predicted 2542
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108991 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00244094 predicted 2656
2 SASI_Rn02_00244095 predicted 3752
3 SASI_Rn02_00244096 predicted 2060
4 SASI_Rn02_00244097 predicted 3938
5 SASI_Rn02_00244098 predicted 1724
6 SASI_Rn02_00244099 predicted 3402
7 SASI_Rn02_00244100 predicted 2106
8 SASI_Rn02_00244101 predicted 1860
9 SASI_Rn02_00244102 predicted 3671
10 SASI_Rn02_00244103 predicted 3204
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_146241 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00083725 predicted 1724
2 SASI_Mm01_00083726 predicted 3143
3 SASI_Mm01_00083728 predicted 2814
4 SASI_Mm01_00083730 predicted 2998
5 SASI_Mm02_00341961 predicted 2729
6 SASI_Mm01_00083731 predicted 914
7 SASI_Mm02_00341962 predicted 788
8 SASI_Mm01_00083732 predicted 2167
9 SASI_Mm01_00083733 predicted 1173
10 SASI_Mm02_00341963 predicted 2783
11 SASI_Mm01_00083727 predicted 1621
12 SASI_Mm01_00083729 predicted 2925
13 SASI_Mm01_00083734 predicted 2473
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013381
TRHDE MISSION shRNA Bacterial Glycerol Stock
thyrotropin-releasing hormone degrading enzyme
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000073833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013381.1-5392s1c1
Sequence:CCGGCCTCATATAATACTTGCTCAACTCGAGTTGAGCAAGTATTATATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013381.1-1364s1c1
Sequence:CCGGCCAGTGTTTCATCTATTTCTTCTCGAGAAGAAATAGATGAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013381.1-2094s1c1
Sequence:CCGGGCACCACAGAATAACTTATTTCTCGAGAAATAAGTTATTCTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013381.1-2284s1c1
Sequence:CCGGGCTGGCTATTTGCCTCAGAATCTCGAGATTCTGAGGCAAATAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000073834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013381.1-939s1c1
Sequence:CCGGGCCAATCTACAAGGCTACTTTCTCGAGAAAGTAGCCTTGTAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000437101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013381.2-740s21c1
Sequence:CCGGACAACGCGCTCATCGAGAATGCTCGAGCATTCTCGATGAGCGCGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000430267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013381.2-2466s21c1
Sequence:CCGGACTACGTAGAGAAGTTATAATCTCGAGATTATAACTTCTCTACGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000421941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013381.2-1128s21c1
Sequence:CCGGGGACTATGCTCTCCATATAACCTCGAGGTTATATGGAGAGCATAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013381.2-1593s21c1
Sequence:CCGGGTTTGACTGGATCGCATATAACTCGAGTTATATGCGATCCAGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013381
TRHDE MISSION shRNA shRNA Plasmid DNA
thyrotropin-releasing hormone degrading enzyme
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000073833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013381.1-5392s1c1
Sequence:CCGGCCTCATATAATACTTGCTCAACTCGAGTTGAGCAAGTATTATATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013381.1-1364s1c1
Sequence:CCGGCCAGTGTTTCATCTATTTCTTCTCGAGAAGAAATAGATGAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013381.1-2094s1c1
Sequence:CCGGGCACCACAGAATAACTTATTTCTCGAGAAATAAGTTATTCTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013381.1-2284s1c1
Sequence:CCGGGCTGGCTATTTGCCTCAGAATCTCGAGATTCTGAGGCAAATAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000073834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013381.1-939s1c1
Sequence:CCGGGCCAATCTACAAGGCTACTTTCTCGAGAAAGTAGCCTTGTAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000437101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013381.2-740s21c1
Sequence:CCGGACAACGCGCTCATCGAGAATGCTCGAGCATTCTCGATGAGCGCGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000430267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013381.2-2466s21c1
Sequence:CCGGACTACGTAGAGAAGTTATAATCTCGAGATTATAACTTCTCTACGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000421941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013381.2-1128s21c1
Sequence:CCGGGGACTATGCTCTCCATATAACCTCGAGGTTATATGGAGAGCATAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013381.2-1593s21c1
Sequence:CCGGGTTTGACTGGATCGCATATAACTCGAGTTATATGCGATCCAGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013381
TRHDE MISSION shRNA Lentiviral Transduction Particles
thyrotropin-releasing hormone degrading enzyme
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000073833    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_013381.1-5392s1c1
Sequence:CCGGCCTCATATAATACTTGCTCAACTCGAGTTGAGCAAGTATTATATGAGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073835    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013381.1-1364s1c1
Sequence:CCGGCCAGTGTTTCATCTATTTCTTCTCGAGAAGAAATAGATGAAACACTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073837    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013381.1-2094s1c1
Sequence:CCGGGCACCACAGAATAACTTATTTCTCGAGAAATAAGTTATTCTGTGGTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073836    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013381.1-2284s1c1
Sequence:CCGGGCTGGCTATTTGCCTCAGAATCTCGAGATTCTGAGGCAAATAGCCAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000073834    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013381.1-939s1c1
Sequence:CCGGGCCAATCTACAAGGCTACTTTCTCGAGAAAGTAGCCTTGTAGATTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000437101    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013381.2-740s21c1
Sequence:CCGGACAACGCGCTCATCGAGAATGCTCGAGCATTCTCGATGAGCGCGTTGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000430267    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013381.2-2466s21c1
Sequence:CCGGACTACGTAGAGAAGTTATAATCTCGAGATTATAACTTCTCTACGTAGTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000421941    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013381.2-1128s21c1
Sequence:CCGGGGACTATGCTCTCCATATAACCTCGAGGTTATATGGAGAGCATAGTCCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419696    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_013381.2-1593s21c1
Sequence:CCGGGTTTGACTGGATCGCATATAACTCGAGTTATATGCGATCCAGTCAAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_146241
TRHDE MISSION shRNA Bacterial Glycerol Stock
thyrotropin-releasing hormone degrading enzyme
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000031103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146241.1-1765s1c1
Sequence:CCGGGCCAGAAATGATCTCTGGAATCTCGAGATTCCAGAGATCATTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146241.1-2954s1c1
Sequence:CCGGCCAAACTTATCAGTGGAGTTACTCGAGTAACTCCACTGATAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146241.1-759s1c1
Sequence:CCGGGCAGAGGCATTACAATCTGAACTCGAGTTCAGATTGTAATGCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146241.1-2136s1c1
Sequence:CCGGCGGCTACTTTAGAGTCAACTACTCGAGTAGTTGACTCTAAAGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000031099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146241.1-2266s1c1
Sequence:CCGGGCAGGCTATTTGCCTCAGAATCTCGAGATTCTGAGGCAAATAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_146241
TRHDE MISSION shRNA shRNA Plasmid DNA
thyrotropin-releasing hormone degrading enzyme
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000031103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146241.1-1765s1c1
Sequence:CCGGGCCAGAAATGATCTCTGGAATCTCGAGATTCCAGAGATCATTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146241.1-2954s1c1
Sequence:CCGGCCAAACTTATCAGTGGAGTTACTCGAGTAACTCCACTGATAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146241.1-759s1c1
Sequence:CCGGGCAGAGGCATTACAATCTGAACTCGAGTTCAGATTGTAATGCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146241.1-2136s1c1
Sequence:CCGGCGGCTACTTTAGAGTCAACTACTCGAGTAGTTGACTCTAAAGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000031099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146241.1-2266s1c1
Sequence:CCGGGCAGGCTATTTGCCTCAGAATCTCGAGATTCTGAGGCAAATAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_146241
TRHDE MISSION shRNA Lentiviral Transduction Particles
thyrotropin-releasing hormone degrading enzyme
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000031103    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146241.1-1765s1c1
Sequence:CCGGGCCAGAAATGATCTCTGGAATCTCGAGATTCCAGAGATCATTTCTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031102    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146241.1-2954s1c1
Sequence:CCGGCCAAACTTATCAGTGGAGTTACTCGAGTAACTCCACTGATAAGTTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031101    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146241.1-759s1c1
Sequence:CCGGGCAGAGGCATTACAATCTGAACTCGAGTTCAGATTGTAATGCCTCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031100    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146241.1-2136s1c1
Sequence:CCGGCGGCTACTTTAGAGTCAACTACTCGAGTAGTTGACTCTAAAGTAGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000031099    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_146241.1-2266s1c1
Sequence:CCGGGCAGGCTATTTGCCTCAGAATCTCGAGATTCTGAGGCAAATAGCCTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks