EMAIL THIS PAGE TO A FRIEND

TRHR

thyrotropin-releasing hormone receptor

Synonyms: TRH-R
UniProtKB ID: P34981, Q2M339
Gene ID:
Human(7201) Summary: This gene encodes a G protein-coupled receptor for thyrotropin-releasing hormone (TRH). Upon binding to TRH, this receptor activates the inositol phospholipid-calcium-protein kinase C transduction pathway. Mutations in this gene have been associated with generalized thyrotropin-releasing hormone resistance. [provided by RefSeq, Sep 2011]
Mouse(22045) thyrotropin releasing hormone receptor
Rat(25570) thyrotropin releasing hormone receptor
chicken(395770) thyrotropin-releasing hormone receptor
domestic cat(101088391) thyrotropin-releasing hormone receptor
dog(482007) thyrotropin-releasing hormone receptor
cow(281549) thyrotropin-releasing hormone receptor
sheep(443425) thyrotropin-releasing hormone receptor
domestic guinea pig(100725810) thyrotropin-releasing hormone receptor
Domestic Rabbit(100347221) thyrotropin-releasing hormone receptor
naked mole-rat(101723120) thyrotropin-releasing hormone receptor
51 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Small Molecule - Antagonist

Product # Description Species Add to Cart
 
P1319 Thyrotropin releasing hormone ≥98% (HPLC), powder human, mouse pricing
G5297 Glp-Asn-Pro-d-Tyr-d-Trp-NH2 ≥98% (HPLC), solid rat pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_013696 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_013696 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_013696 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_003301 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_003301 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_003301 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_003301 Rosetta Predictions human pricing
NM_013047 Rosetta Predictions rat pricing
NM_013696 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_003301 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00081939 predicted 326
2 SASI_Hs01_00081940 predicted 535
3 SASI_Hs01_00081941 predicted 641
4 SASI_Hs01_00081942 predicted 299
5 SASI_Hs01_00081943 predicted 578
6 SASI_Hs01_00081944 predicted 642
7 SASI_Hs01_00081945 predicted 579
8 SASI_Hs01_00081946 predicted 750
9 SASI_Hs01_00081947 predicted 726
10 SASI_Hs01_00081948 predicted 643
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013047 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00091299 predicted 872
2 SASI_Rn01_00091300 predicted 1453
3 SASI_Rn01_00091301 predicted 1362
4 SASI_Rn01_00091302 predicted 496
5 SASI_Rn01_00091303 predicted 1148
6 SASI_Rn02_00260773 predicted 773
7 SASI_Rn01_00091305 predicted 641
8 SASI_Rn01_00091306 predicted 894
9 SASI_Rn01_00091307 predicted 1055
10 SASI_Rn01_00091308 predicted 960
11 SASI_Rn01_00091304 predicted 938
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_013696 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00148198 predicted 899
2 SASI_Mm01_00148199 predicted 1381
3 SASI_Mm01_00148201 predicted 1259
4 SASI_Mm01_00148202 predicted 905
5 SASI_Mm01_00148203 predicted 885
6 SASI_Mm01_00148204 predicted 698
7 SASI_Mm02_00322585 predicted 1586
8 SASI_Mm01_00148205 predicted 422
9 SASI_Mm01_00148206 predicted 1452
10 SASI_Mm02_00322586 predicted 841
11 SASI_Mm01_00148200 predicted 1068
12 SASI_Mm01_00148207 predicted 1518
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_013696
TRHR MISSION shRNA Bacterial Glycerol Stock
thyrotropin-releasing hormone receptor
Mouse
5 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000027839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013696.1-1063s1c1
Sequence:CCGGGCAGTGGTTGTAATTCTGTTTCTCGAGAAACAGAATTACAACCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013696.1-1206s1c1
Sequence:CCGGCCCAGTGATTTACAACCTCATCTCGAGATGAGGTTGTAAATCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013696.1-655s1c1
Sequence:CCGGGCCCAGTTTCTCTGCACGTTTCTCGAGAAACGTGCAGAGAAACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013696.1-341s1c1
Sequence:CCGGCCATCTTACTTGTGGTCATTACTCGAGTAATGACCACAAGTAAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000027853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013696.1-1311s1c1
Sequence:CCGGCCTAAATTACAGTGTCATCAACTCGAGTTGATGACACTGTAATTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_013696
TRHR MISSION shRNA shRNA Plasmid DNA
thyrotropin-releasing hormone receptor
Mouse
5 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000027839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013696.1-1063s1c1
Sequence:CCGGGCAGTGGTTGTAATTCTGTTTCTCGAGAAACAGAATTACAACCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013696.1-1206s1c1
Sequence:CCGGCCCAGTGATTTACAACCTCATCTCGAGATGAGGTTGTAAATCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013696.1-655s1c1
Sequence:CCGGGCCCAGTTTCTCTGCACGTTTCTCGAGAAACGTGCAGAGAAACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013696.1-341s1c1
Sequence:CCGGCCATCTTACTTGTGGTCATTACTCGAGTAATGACCACAAGTAAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000027853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013696.1-1311s1c1
Sequence:CCGGCCTAAATTACAGTGTCATCAACTCGAGTTGATGACACTGTAATTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_013696
TRHR MISSION shRNA Lentiviral Transduction Particles
thyrotropin-releasing hormone receptor
Mouse
5 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000027839    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013696.1-1063s1c1
Sequence:CCGGGCAGTGGTTGTAATTCTGTTTCTCGAGAAACAGAATTACAACCACTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027830    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013696.1-1206s1c1
Sequence:CCGGCCCAGTGATTTACAACCTCATCTCGAGATGAGGTTGTAAATCACTGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027770    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013696.1-655s1c1
Sequence:CCGGGCCCAGTTTCTCTGCACGTTTCTCGAGAAACGTGCAGAGAAACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027813    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013696.1-341s1c1
Sequence:CCGGCCATCTTACTTGTGGTCATTACTCGAGTAATGACCACAAGTAAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000027853    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_013696.1-1311s1c1
Sequence:CCGGCCTAAATTACAGTGTCATCAACTCGAGTTGATGACACTGTAATTTAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_003301
TRHR MISSION shRNA Bacterial Glycerol Stock
thyrotropin-releasing hormone receptor
Human
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000014188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003301.1-416s1c1
Sequence:CCGGGCCCAGTTTCTCTGCACATTTCTCGAGAAATGTGCAGAGAAACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003301.1-328s1c1
Sequence:CCGGCCTCCAGTATTTGGGAATTAACTCGAGTTAATTCCCAAATACTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003301.1-102s1c1
Sequence:CCGGCCATCTTACTTGTACTCATTACTCGAGTAATGAGTACAAGTAAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003301.1-587s1c1
Sequence:CCGGCCTATTTACCTAATGGACTTTCTCGAGAAAGTCCATTAGGTAAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000014189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003301.1-967s1c1
Sequence:CCGGCCCGGTGATTTACAATCTCATCTCGAGATGAGATTGTAAATCACCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003301.3-571s21c1
Sequence:CCGGGAATTACTACTCACCTATTTACTCGAGTAAATAGGTGAGTAGTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003301.3-954s21c1
Sequence:CCGGGTGCCATCAACCCGGTGATTTCTCGAGAAATCACCGGGTTGATGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000358148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003301.3-869s21c1
Sequence:CCGGCTAGTGGTTGTCAACTCATTTCTCGAGAAATGAGTTGACAACCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_003301
TRHR MISSION shRNA shRNA Plasmid DNA
thyrotropin-releasing hormone receptor
Human
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000014188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003301.1-416s1c1
Sequence:CCGGGCCCAGTTTCTCTGCACATTTCTCGAGAAATGTGCAGAGAAACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003301.1-328s1c1
Sequence:CCGGCCTCCAGTATTTGGGAATTAACTCGAGTTAATTCCCAAATACTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003301.1-102s1c1
Sequence:CCGGCCATCTTACTTGTACTCATTACTCGAGTAATGAGTACAAGTAAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003301.1-587s1c1
Sequence:CCGGCCTATTTACCTAATGGACTTTCTCGAGAAAGTCCATTAGGTAAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000014189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003301.1-967s1c1
Sequence:CCGGCCCGGTGATTTACAATCTCATCTCGAGATGAGATTGTAAATCACCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003301.3-571s21c1
Sequence:CCGGGAATTACTACTCACCTATTTACTCGAGTAAATAGGTGAGTAGTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003301.3-954s21c1
Sequence:CCGGGTGCCATCAACCCGGTGATTTCTCGAGAAATCACCGGGTTGATGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000358148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003301.3-869s21c1
Sequence:CCGGCTAGTGGTTGTCAACTCATTTCTCGAGAAATGAGTTGACAACCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_003301
TRHR MISSION shRNA Lentiviral Transduction Particles
thyrotropin-releasing hormone receptor
Human
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000014188    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003301.1-416s1c1
Sequence:CCGGGCCCAGTTTCTCTGCACATTTCTCGAGAAATGTGCAGAGAAACTGGGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014190    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003301.1-328s1c1
Sequence:CCGGCCTCCAGTATTTGGGAATTAACTCGAGTTAATTCCCAAATACTGGAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014192    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003301.1-102s1c1
Sequence:CCGGCCATCTTACTTGTACTCATTACTCGAGTAATGAGTACAAGTAAGATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014191    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003301.1-587s1c1
Sequence:CCGGCCTATTTACCTAATGGACTTTCTCGAGAAAGTCCATTAGGTAAATAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000014189    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_003301.1-967s1c1
Sequence:CCGGCCCGGTGATTTACAATCTCATCTCGAGATGAGATTGTAAATCACCGGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358219    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003301.3-571s21c1
Sequence:CCGGGAATTACTACTCACCTATTTACTCGAGTAAATAGGTGAGTAGTAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358146    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003301.3-954s21c1
Sequence:CCGGGTGCCATCAACCCGGTGATTTCTCGAGAAATCACCGGGTTGATGGCACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000358148    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_003301.3-869s21c1
Sequence:CCGGCTAGTGGTTGTCAACTCATTTCTCGAGAAATGAGTTGACAACCACTAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks