EMAIL THIS PAGE TO A FRIEND

TRIAP1

TP53 regulated inhibitor of apoptosis 1

Synonyms: MDM35 P53CSV WF-1
UniProtKB ID: O43715, B2R4Z7, Q5RKS5, Q6LCA7
Gene ID:
Mouse(69076) TP53 regulated inhibitor of apoptosis 1
Rat(691278) TP53 regulated inhibitor of apoptosis 1
cow(525164) TP53 regulated inhibitor of apoptosis 1
sheep(101118643) TP53 regulated inhibitor of apoptosis 1
domestic guinea pig(100717880) TP53 regulated inhibitor of apoptosis 1
naked mole-rat(101698065) TP53 regulated inhibitor of apoptosis 1
Zebrafish(550367) TP53 regulated inhibitor of apoptosis 1
dog(489217) TP53 regulated inhibitor of apoptosis 1
domestic cat(101096014) TP53 regulated inhibitor of apoptosis 1
chicken(416977) TP53 regulated inhibitor of apoptosis 1
61 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_016399 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_016399 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_016399 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_026933 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_026933 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_026933 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_016399 Rosetta Predictions human pricing
NM_001126099 Rosetta Predictions rat pricing
NM_026933 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_016399 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00021380 predicted 553
2 SASI_Hs01_00021382 predicted 771
3 SASI_Hs01_00021383 predicted 715
4 SASI_Hs01_00021384 predicted 265
5 SASI_Hs02_00349405 predicted 657
6 SASI_Hs01_00021386 predicted 300
7 SASI_Hs02_00349406 predicted 286
8 SASI_Hs01_00021387 predicted 192
9 SASI_Hs01_00021388 predicted 206
10 SASI_Hs01_00021389 predicted 218
11 SASI_Hs01_00021381 predicted 366
12 SASI_Hs01_00021385 predicted 534
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001126099 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00253003 predicted 691
2 SASI_Rn02_00253004 predicted 595
3 SASI_Rn02_00253005 predicted 569
4 SASI_Rn02_00253006 predicted 222
5 SASI_Rn02_00253007 predicted 273
6 SASI_Rn02_00253008 predicted 348
7 SASI_Rn02_00253009 predicted 502
8 SASI_Rn02_00253010 predicted 611
9 SASI_Rn02_00253011 predicted 394
10 SASI_Rn02_00253012 predicted 582
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_026933 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00082469 predicted 324
2 SASI_Mm01_00082470 predicted 646
3 SASI_Mm01_00082471 predicted 210
4 SASI_Mm01_00082472 predicted 476
5 SASI_Mm01_00082473 predicted 511
6 SASI_Mm01_00082474 predicted 641
7 SASI_Mm01_00082475 predicted 263
8 SASI_Mm01_00082476 predicted 661
9 SASI_Mm01_00082477 predicted 560
10 SASI_Mm01_00082478 predicted 264
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_016399
VALIDATED
TRIAP1 MISSION shRNA Bacterial Glycerol Stock
TP53 regulated inhibitor of apoptosis 1
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000145202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016399.2-182s1c1
Sequence:CCGGGTTCAGAAAGCAATAAAGGAGCTCGAGCTCCTTTATTGCTTTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000144153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016399.2-554s1c1
Sequence:CCGGCCTTGTATGCAAACGATGATACTCGAGTATCATCGTTTGCATACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016399.2-206s1c1
Sequence:CCGGGAGATTCCTATTGAAGGACTGCTCGAGCAGTCCTTCAATAGGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016399.2-213s1c1
Sequence:CCGGCTATTGAAGGACTGGAGTTCACTCGAGTGAACTCCAGTCCTTCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016399.2-208s1c1
Sequence:CCGGGATTCCTATTGAAGGACTGGACTCGAGTCCAGTCCTTCAATAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000142220    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016399.2-950s1c1
Sequence:CCGGGCTGTGGAGGAAGAACCTAAACTCGAGTTTAGGTTCTTCCTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000143082    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016399.2-1001s1c1
Sequence:CCGGCCCAAGTCAGTGAATTGTCAACTCGAGTTGACAATTCACTGACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016399.2-80s1c1
Sequence:CCGGGAGTACGACCAGTGCTTCAATCTCGAGATTGAAGCACTGGTCGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000121581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016399.2-185s1c1
Sequence:CCGGCAGAAAGCAATAAAGGAGAAACTCGAGTTTCTCCTTTATTGCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122631    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016399.2-527s1c1
Sequence:CCGGGCGTGGAATCAGCTTTACATACTCGAGTATGTAAAGCTGATTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000122393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016399.2-175s1c1
Sequence:CCGGGCAGTGTGTTCAGAAAGCAATCTCGAGATTGCTTTCTGAACACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000419264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016399.2-390s21c1
Sequence:CCGGTTATTTCCTCCTTCGATGTTTCTCGAGAAACATCGAAGGAGGAAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000414384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016399.2-343s21c1
Sequence:CCGGGTGAACATAGCCATCAGATTTCTCGAGAAATCTGATGGCTATGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000417422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016399.2-684s21c1
Sequence:CCGGTTTCCTCTCAGGGAACTAATGCTCGAGCATTAGTTCCCTGAGAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_016399
VALIDATED
TRIAP1 MISSION shRNA shRNA Plasmid DNA
TP53 regulated inhibitor of apoptosis 1
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000145202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016399.2-182s1c1
Sequence:CCGGGTTCAGAAAGCAATAAAGGAGCTCGAGCTCCTTTATTGCTTTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000144153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016399.2-554s1c1
Sequence:CCGGCCTTGTATGCAAACGATGATACTCGAGTATCATCGTTTGCATACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016399.2-206s1c1
Sequence:CCGGGAGATTCCTATTGAAGGACTGCTCGAGCAGTCCTTCAATAGGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016399.2-213s1c1
Sequence:CCGGCTATTGAAGGACTGGAGTTCACTCGAGTGAACTCCAGTCCTTCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016399.2-208s1c1
Sequence:CCGGGATTCCTATTGAAGGACTGGACTCGAGTCCAGTCCTTCAATAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000142220    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016399.2-950s1c1
Sequence:CCGGGCTGTGGAGGAAGAACCTAAACTCGAGTTTAGGTTCTTCCTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000143082    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016399.2-1001s1c1
Sequence:CCGGCCCAAGTCAGTGAATTGTCAACTCGAGTTGACAATTCACTGACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016399.2-80s1c1
Sequence:CCGGGAGTACGACCAGTGCTTCAATCTCGAGATTGAAGCACTGGTCGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000121581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016399.2-185s1c1
Sequence:CCGGCAGAAAGCAATAAAGGAGAAACTCGAGTTTCTCCTTTATTGCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122631    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016399.2-527s1c1
Sequence:CCGGGCGTGGAATCAGCTTTACATACTCGAGTATGTAAAGCTGATTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000122393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016399.2-175s1c1
Sequence:CCGGGCAGTGTGTTCAGAAAGCAATCTCGAGATTGCTTTCTGAACACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000419264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016399.2-390s21c1
Sequence:CCGGTTATTTCCTCCTTCGATGTTTCTCGAGAAACATCGAAGGAGGAAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000414384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016399.2-343s21c1
Sequence:CCGGGTGAACATAGCCATCAGATTTCTCGAGAAATCTGATGGCTATGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000417422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016399.2-684s21c1
Sequence:CCGGTTTCCTCTCAGGGAACTAATGCTCGAGCATTAGTTCCCTGAGAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_016399
VALIDATED
TRIAP1 MISSION shRNA Lentiviral Transduction Particles
TP53 regulated inhibitor of apoptosis 1
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000145202    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016399.2-182s1c1
Sequence:CCGGGTTCAGAAAGCAATAAAGGAGCTCGAGCTCCTTTATTGCTTTCTGAACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000144153    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.68 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016399.2-554s1c1
Sequence:CCGGCCTTGTATGCAAACGATGATACTCGAGTATCATCGTTTGCATACAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143602    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.79 Cell Line: 293T/17
TRC Version: 1.5 Clone ID:NM_016399.2-206s1c1
Sequence:CCGGGAGATTCCTATTGAAGGACTGCTCGAGCAGTCCTTCAATAGGAATCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143046    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016399.2-213s1c1
Sequence:CCGGCTATTGAAGGACTGGAGTTCACTCGAGTGAACTCCAGTCCTTCAATAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143495    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016399.2-208s1c1
Sequence:CCGGGATTCCTATTGAAGGACTGGACTCGAGTCCAGTCCTTCAATAGGAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000142220    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.8 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016399.2-950s1c1
Sequence:CCGGGCTGTGGAGGAAGAACCTAAACTCGAGTTTAGGTTCTTCCTCCACAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000143082    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.74 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016399.2-1001s1c1
Sequence:CCGGCCCAAGTCAGTGAATTGTCAACTCGAGTTGACAATTCACTGACTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122664    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016399.2-80s1c1
Sequence:CCGGGAGTACGACCAGTGCTTCAATCTCGAGATTGAAGCACTGGTCGTACTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000121581    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_016399.2-185s1c1
Sequence:CCGGCAGAAAGCAATAAAGGAGAAACTCGAGTTTCTCCTTTATTGCTTTCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122631    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: 293T/17
TRC Version: 1 Clone ID:NM_016399.2-527s1c1
Sequence:CCGGGCGTGGAATCAGCTTTACATACTCGAGTATGTAAAGCTGATTCCACGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000122393    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_016399.2-175s1c1
Sequence:CCGGGCAGTGTGTTCAGAAAGCAATCTCGAGATTGCTTTCTGAACACACTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000419264    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016399.2-390s21c1
Sequence:CCGGTTATTTCCTCCTTCGATGTTTCTCGAGAAACATCGAAGGAGGAAATAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000414384    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016399.2-343s21c1
Sequence:CCGGGTGAACATAGCCATCAGATTTCTCGAGAAATCTGATGGCTATGTTCACTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000417422    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_016399.2-684s21c1
Sequence:CCGGTTTCCTCTCAGGGAACTAATGCTCGAGCATTAGTTCCCTGAGAGGAAATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_026933
VALIDATED
TRIAP1 MISSION shRNA Bacterial Glycerol Stock
TP53 regulated inhibitor of apoptosis 1
Mouse
12 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000201081    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026933.1-498s1c1
Sequence:CCGGCCTTGGATATGAGTATGGTAACTCGAGTTACCATACTCATATCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026933.1-169s1c1
Sequence:CCGGGCAGAAAGCAATCAAGGAGAACTCGAGTTCTCCTTGATTGCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026933.1-185s1c1
Sequence:CCGGGAGAAAGAGATTCCTATTGAACTCGAGTTCAATAGGAATCTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026933.1-773s1c1
Sequence:CCGGCCATTCAGAATCTTCAGAAATCTCGAGATTTCTGAAGATTCTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000192970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026933.1-176s1c1
Sequence:CCGGGCAATCAAGGAGAAAGAGATTCTCGAGAATCTCTTTCTCCTTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000215906    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026933.2-265s1c1
Sequence:CCGGCACTTGGAAGACATCAGTAAACTCGAGTTTACTGATGTCTTCCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000217587    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026933.2-527s1c1
Sequence:CCGGGATTAAGGATGGCAGCATTTGCTCGAGCAAATGCTGCCATCCTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000350166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026933.2-175s21c1
Sequence:CCGGGCAATCAAGGAGAAAGAGATTCTCGAGAATCTCTTTCTCCTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000320159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026933.2-184s21c1
Sequence:CCGGGAGAAAGAGATTCCTATTGAACTCGAGTTCAATAGGAATCTCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026933.2-211s21c1
Sequence:CCGGGAGTTCATGGGCCATGGCAAACTCGAGTTTGCCATGGCCCATGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026933.2-772s21c1
Sequence:CCGGCCATTCAGAATCTTCAGAAATCTCGAGATTTCTGAAGATTCTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000277211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026933.2-136s21c1
Sequence:CCGGACCGACCTCTTCAAACGCTACCTCGAGGTAGCGTTTGAAGAGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_026933
VALIDATED
TRIAP1 MISSION shRNA shRNA Plasmid DNA
TP53 regulated inhibitor of apoptosis 1
Mouse
12 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000201081    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026933.1-498s1c1
Sequence:CCGGCCTTGGATATGAGTATGGTAACTCGAGTTACCATACTCATATCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026933.1-169s1c1
Sequence:CCGGGCAGAAAGCAATCAAGGAGAACTCGAGTTCTCCTTGATTGCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026933.1-185s1c1
Sequence:CCGGGAGAAAGAGATTCCTATTGAACTCGAGTTCAATAGGAATCTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026933.1-773s1c1
Sequence:CCGGCCATTCAGAATCTTCAGAAATCTCGAGATTTCTGAAGATTCTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000192970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026933.1-176s1c1
Sequence:CCGGGCAATCAAGGAGAAAGAGATTCTCGAGAATCTCTTTCTCCTTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000215906    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026933.2-265s1c1
Sequence:CCGGCACTTGGAAGACATCAGTAAACTCGAGTTTACTGATGTCTTCCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000217587    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026933.2-527s1c1
Sequence:CCGGGATTAAGGATGGCAGCATTTGCTCGAGCAAATGCTGCCATCCTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000350166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026933.2-175s21c1
Sequence:CCGGGCAATCAAGGAGAAAGAGATTCTCGAGAATCTCTTTCTCCTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000320159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026933.2-184s21c1
Sequence:CCGGGAGAAAGAGATTCCTATTGAACTCGAGTTCAATAGGAATCTCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026933.2-211s21c1
Sequence:CCGGGAGTTCATGGGCCATGGCAAACTCGAGTTTGCCATGGCCCATGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026933.2-772s21c1
Sequence:CCGGCCATTCAGAATCTTCAGAAATCTCGAGATTTCTGAAGATTCTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000277211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026933.2-136s21c1
Sequence:CCGGACCGACCTCTTCAAACGCTACCTCGAGGTAGCGTTTGAAGAGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_026933
VALIDATED
TRIAP1 MISSION shRNA Lentiviral Transduction Particles
TP53 regulated inhibitor of apoptosis 1
Mouse
12 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000201081    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026933.1-498s1c1
Sequence:CCGGCCTTGGATATGAGTATGGTAACTCGAGTTACCATACTCATATCCAAGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190616    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.93 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026933.1-169s1c1
Sequence:CCGGGCAGAAAGCAATCAAGGAGAACTCGAGTTCTCCTTGATTGCTTTCTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191546    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026933.1-185s1c1
Sequence:CCGGGAGAAAGAGATTCCTATTGAACTCGAGTTCAATAGGAATCTCTTTCTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192010    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.92 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026933.1-773s1c1
Sequence:CCGGCCATTCAGAATCTTCAGAAATCTCGAGATTTCTGAAGATTCTGAATGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000192970    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_026933.1-176s1c1
Sequence:CCGGGCAATCAAGGAGAAAGAGATTCTCGAGAATCTCTTTCTCCTTGATTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000215906    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026933.2-265s1c1
Sequence:CCGGCACTTGGAAGACATCAGTAAACTCGAGTTTACTGATGTCTTCCAAGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000217587    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_026933.2-527s1c1
Sequence:CCGGGATTAAGGATGGCAGCATTTGCTCGAGCAAATGCTGCCATCCTTAATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000350166    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.97 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026933.2-175s21c1
Sequence:CCGGGCAATCAAGGAGAAAGAGATTCTCGAGAATCTCTTTCTCCTTGATTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000320159    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026933.2-184s21c1
Sequence:CCGGGAGAAAGAGATTCCTATTGAACTCGAGTTCAATAGGAATCTCTTTCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277210    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026933.2-211s21c1
Sequence:CCGGGAGTTCATGGGCCATGGCAAACTCGAGTTTGCCATGGCCCATGAACTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277151    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.95 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026933.2-772s21c1
Sequence:CCGGCCATTCAGAATCTTCAGAAATCTCGAGATTTCTGAAGATTCTGAATGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000277211    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_026933.2-136s21c1
Sequence:CCGGACCGACCTCTTCAAACGCTACCTCGAGGTAGCGTTTGAAGAGGTCGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks