EMAIL THIS PAGE TO A FRIEND

TRIB1

tribbles homolog 1 (Drosophila)

Synonyms: C8FW GIG2 SKIP1 TRB1
UniProtKB ID: Q96RU8, C5HU08, O15180, Q9H2Y8
Gene ID:
Mouse(211770) tribbles homolog 1 (Drosophila)
Rat(78969) tribbles homolog 1 (Drosophila)
Zebrafish(792957) tribbles homolog 1 (Drosophila)
Horse(100033926) tribbles homolog 1 (Drosophila)
domestic cat(101087043) tribbles homolog 1 (Drosophila)
dog(482039) tribbles homolog 1 (Drosophila)
chicken(776883) tribbles homolog 1 (Drosophila)
naked mole-rat(101707049) tribbles homolog 1 (Drosophila)
domestic guinea pig(100732372) tribbles homolog 1 (Drosophila)
cow(521857) tribbles homolog 1 (Drosophila)
sheep(101102400) tribbles homolog 1 (Drosophila)
128 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_025195 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_025195 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_025195 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_144549 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144549 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144549 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_025195 Rosetta Predictions human pricing
NM_023985 Rosetta Predictions rat pricing
NM_144549 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025195 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00068669 predicted 1713
2 SASI_Hs01_00068671 predicted 1931
3 SASI_Hs01_00068672 predicted 1281
4 SASI_Hs01_00068674 predicted 1616
5 SASI_Hs01_00068675 predicted 1885
6 SASI_Hs01_00068676 predicted 1786
7 SASI_Hs01_00068677 predicted 1944
8 SASI_Hs01_00068678 predicted 1866
9 SASI_Hs02_00357970 predicted 1471
10 SASI_Hs02_00357971 predicted 1928
11 SASI_Hs01_00068670 predicted 1237
12 SASI_Hs01_00068673 predicted 1679
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_023985 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00263808 predicted 1307
2 SASI_Rn02_00263809 predicted 953
3 SASI_Rn02_00263810 predicted 1310
4 SASI_Rn02_00263811 predicted 1052
5 SASI_Rn02_00263812 predicted 954
6 SASI_Rn02_00263813 predicted 1281
7 SASI_Rn02_00263814 predicted 1368
8 SASI_Rn02_00263815 predicted 1346
9 SASI_Rn02_00263816 predicted 1268
10 SASI_Rn02_00263817 predicted 1145
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144549 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00103746 predicted 1657
2 SASI_Mm01_00103747 predicted 1661
3 SASI_Mm01_00103748 predicted 1774
4 SASI_Mm01_00103749 predicted 1568
5 SASI_Mm01_00103750 predicted 1503
6 SASI_Mm01_00103751 predicted 1316
7 SASI_Mm01_00103752 predicted 1445
8 SASI_Mm01_00103753 predicted 1494
9 SASI_Mm01_00103754 predicted 975
10 SASI_Mm01_00103755 predicted 1008
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025195
TRIB1 MISSION shRNA Bacterial Glycerol Stock
tribbles homolog 1 (Drosophila)
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000382399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025195.2-1235s21c1
Sequence:GTACCGGGAACCCAGCTTAGACTAGAAACTCGAGTTTCTAGTCTAAGCTGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025195.2-2048s21c1
Sequence:GTACCGGGCAAATCGCACAATGACATATCTCGAGATATGTCATTGTGCGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000381806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025195.2-1202s21c1
Sequence:GTACCGGAGCTTAGGAAGTTCGTCTTCTCTCGAGAGAAGACGAACTTCCTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025195.2-1624s1c1
Sequence:CCGGGACTCAGAAATAGGAACTTCACTCGAGTGAAGTTCCTATTTCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000195718    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025195.2-3098s1c1
Sequence:CCGGCAGGTGGTTAAACGGGTAAACCTCGAGGTTTACCCGTTTAACCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025195.x-1691s1c1
Sequence:CCGGCCGGTGGTCAAGTGTGTAATACTCGAGTATTACACACTTGACCACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025195.x-1365s1c1
Sequence:CCGGCAGTGACATTAGTTCCTTCTTCTCGAGAAGAAGGAACTAATGTCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025195.x-641s1c1
Sequence:CCGGCCATTAAACACTACCAGGACACTCGAGTGTCCTGGTAGTGTTTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000001536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025195.x-1305s1c1
Sequence:CCGGCGGGTACATCGACTCAGAAATCTCGAGATTTCTGAGTCGATGTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025195
TRIB1 MISSION shRNA shRNA Plasmid DNA
tribbles homolog 1 (Drosophila)
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000382399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025195.2-1235s21c1
Sequence:GTACCGGGAACCCAGCTTAGACTAGAAACTCGAGTTTCTAGTCTAAGCTGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025195.2-2048s21c1
Sequence:GTACCGGGCAAATCGCACAATGACATATCTCGAGATATGTCATTGTGCGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000381806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025195.2-1202s21c1
Sequence:GTACCGGAGCTTAGGAAGTTCGTCTTCTCTCGAGAGAAGACGAACTTCCTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025195.2-1624s1c1
Sequence:CCGGGACTCAGAAATAGGAACTTCACTCGAGTGAAGTTCCTATTTCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000195718    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025195.2-3098s1c1
Sequence:CCGGCAGGTGGTTAAACGGGTAAACCTCGAGGTTTACCCGTTTAACCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025195.x-1691s1c1
Sequence:CCGGCCGGTGGTCAAGTGTGTAATACTCGAGTATTACACACTTGACCACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025195.x-1365s1c1
Sequence:CCGGCAGTGACATTAGTTCCTTCTTCTCGAGAAGAAGGAACTAATGTCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025195.x-641s1c1
Sequence:CCGGCCATTAAACACTACCAGGACACTCGAGTGTCCTGGTAGTGTTTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000001536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025195.x-1305s1c1
Sequence:CCGGCGGGTACATCGACTCAGAAATCTCGAGATTTCTGAGTCGATGTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025195
TRIB1 MISSION shRNA Lentiviral Transduction Particles
tribbles homolog 1 (Drosophila)
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000382399    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025195.2-1235s21c1
Sequence:GTACCGGGAACCCAGCTTAGACTAGAAACTCGAGTTTCTAGTCTAAGCTGGGTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381401    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025195.2-2048s21c1
Sequence:GTACCGGGCAAATCGCACAATGACATATCTCGAGATATGTCATTGTGCGATTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000381806    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025195.2-1202s21c1
Sequence:GTACCGGAGCTTAGGAAGTTCGTCTTCTCTCGAGAGAAGACGAACTTCCTAAGCTTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196863    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_025195.2-1624s1c1
Sequence:CCGGGACTCAGAAATAGGAACTTCACTCGAGTGAAGTTCCTATTTCTGAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000195718    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_025195.2-3098s1c1
Sequence:CCGGCAGGTGGTTAAACGGGTAAACCTCGAGGTTTACCCGTTTAACCACCTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001535    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_025195.x-1691s1c1
Sequence:CCGGCCGGTGGTCAAGTGTGTAATACTCGAGTATTACACACTTGACCACCGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001537    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025195.x-1365s1c1
Sequence:CCGGCAGTGACATTAGTTCCTTCTTCTCGAGAAGAAGGAACTAATGTCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001539    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025195.x-641s1c1
Sequence:CCGGCCATTAAACACTACCAGGACACTCGAGTGTCCTGGTAGTGTTTAATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000001536    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_025195.x-1305s1c1
Sequence:CCGGCGGGTACATCGACTCAGAAATCTCGAGATTTCTGAGTCGATGTACCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144549
VALIDATED
TRIB1 MISSION shRNA Bacterial Glycerol Stock
tribbles homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000276654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144549.4-1215s21c1
Sequence:CCGGGATGATGCGCTGTCAGATAAACTCGAGTTTATCTGACAGCGCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144549.4-980s21c1
Sequence:CCGGCGTCTTCTTCGAGAAGGACTTCTCGAGAAGTCCTTCTCGAAGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144549.4-1510s21c1
Sequence:CCGGTCCATCCCTGGTTCGAGTATGCTCGAGCATACTCGAACCAGGGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144549.4-1188s21c1
Sequence:CCGGGAAGATACTCACATCATTAAGCTCGAGCTTAATGATGTGAGTATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144549.4-1921s21c1
Sequence:CCGGTAGTAGTGAACTTGAACATTTCTCGAGAAATGTTCAAGTTCACTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144549.2-1541s1c1
Sequence:CCGGCGGGCTATGTTGACTCAGAAACTCGAGTTTCTGAGTCAACATAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144549.2-1602s1c1
Sequence:CCGGCAGTGACATAAGTTCCTTCTTCTCGAGAAGAAGGAACTTATGTCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144549.2-981s1c1
Sequence:CCGGCGTCTTCTTCGAGAAGGACTTCTCGAGAAGTCCTTCTCGAAGAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144549.2-927s1c1
Sequence:CCGGCCATAGCAACATCACTGGCATCTCGAGATGCCAGTGATGTTGCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144549.2-1060s1c1
Sequence:CCGGCGGCTCTTCAAGCAGATTGTTCTCGAGAACAATCTGCTTGAAGAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144549
VALIDATED
TRIB1 MISSION shRNA shRNA Plasmid DNA
tribbles homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000276654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144549.4-1215s21c1
Sequence:CCGGGATGATGCGCTGTCAGATAAACTCGAGTTTATCTGACAGCGCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144549.4-980s21c1
Sequence:CCGGCGTCTTCTTCGAGAAGGACTTCTCGAGAAGTCCTTCTCGAAGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144549.4-1510s21c1
Sequence:CCGGTCCATCCCTGGTTCGAGTATGCTCGAGCATACTCGAACCAGGGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144549.4-1188s21c1
Sequence:CCGGGAAGATACTCACATCATTAAGCTCGAGCTTAATGATGTGAGTATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144549.4-1921s21c1
Sequence:CCGGTAGTAGTGAACTTGAACATTTCTCGAGAAATGTTCAAGTTCACTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144549.2-1541s1c1
Sequence:CCGGCGGGCTATGTTGACTCAGAAACTCGAGTTTCTGAGTCAACATAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144549.2-1602s1c1
Sequence:CCGGCAGTGACATAAGTTCCTTCTTCTCGAGAAGAAGGAACTTATGTCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144549.2-981s1c1
Sequence:CCGGCGTCTTCTTCGAGAAGGACTTCTCGAGAAGTCCTTCTCGAAGAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144549.2-927s1c1
Sequence:CCGGCCATAGCAACATCACTGGCATCTCGAGATGCCAGTGATGTTGCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144549.2-1060s1c1
Sequence:CCGGCGGCTCTTCAAGCAGATTGTTCTCGAGAACAATCTGCTTGAAGAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144549
VALIDATED
TRIB1 MISSION shRNA Lentiviral Transduction Particles
tribbles homolog 1 (Drosophila)
Mouse
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000276654    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.75 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144549.4-1215s21c1
Sequence:CCGGGATGATGCGCTGTCAGATAAACTCGAGTTTATCTGACAGCGCATCATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276652    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.81 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144549.4-980s21c1
Sequence:CCGGCGTCTTCTTCGAGAAGGACTTCTCGAGAAGTCCTTCTCGAAGAAGACGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276651    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144549.4-1510s21c1
Sequence:CCGGTCCATCCCTGGTTCGAGTATGCTCGAGCATACTCGAACCAGGGATGGATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276716    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.72 Cell Line: Hepa 1-6
TRC Version: 2 Clone ID:NM_144549.4-1188s21c1
Sequence:CCGGGAAGATACTCACATCATTAAGCTCGAGCTTAATGATGTGAGTATCTTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276715    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144549.4-1921s21c1
Sequence:CCGGTAGTAGTGAACTTGAACATTTCTCGAGAAATGTTCAAGTTCACTACTATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024409    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.68 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144549.2-1541s1c1
Sequence:CCGGCGGGCTATGTTGACTCAGAAACTCGAGTTTCTGAGTCAACATAGCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024412    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144549.2-1602s1c1
Sequence:CCGGCAGTGACATAAGTTCCTTCTTCTCGAGAAGAAGGAACTTATGTCACTGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024413    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_144549.2-981s1c1
Sequence:CCGGCGTCTTCTTCGAGAAGGACTTCTCGAGAAGTCCTTCTCGAAGAAGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024411    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144549.2-927s1c1
Sequence:CCGGCCATAGCAACATCACTGGCATCTCGAGATGCCAGTGATGTTGCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024410    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144549.2-1060s1c1
Sequence:CCGGCGGCTCTTCAAGCAGATTGTTCTCGAGAACAATCTGCTTGAAGAGCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks