EMAIL THIS PAGE TO A FRIEND

TRIB2

tribbles homolog 2 (Drosophila)

Synonyms: C5FW GS3955 TRB2
UniProtKB ID: Q92519, B2R851, D6W510
Gene ID:
Human(28951) Summary: This gene encodes one of three members of the Tribbles family. The Tribbles members share a Trb domain, which is homologous to protein serine-threonine kinases, but lacks the active site lysine and probably lacks a catalytic function. The Tribbles proteins interact and modulate the activity of signal transduction pathways in a number of physiological and pathological processes. This Tribbles member induces apoptosis of cells mainly of the hematopoietic origin. It has been identified as a protein up-regulated by inflammatory stimuli in myeloid (THP-1) cells, and also as an oncogene that inactivates the transcription factor C/EBPalpha (CCAAT/enhancer-binding protein alpha) and causes acute myelogenous leukemia. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Mar 2009]
Mouse(217410) tribbles homolog 2 (Drosophila)
Rat(313974) tribbles homolog 2 (Drosophila)
cow(352960) tribbles homolog 2 (Drosophila)
sheep(101121332) tribbles homolog 2 (Drosophila)
domestic guinea pig(100718073) tribbles homolog 2 (Drosophila)
naked mole-rat(101720665) tribbles homolog 2 (Drosophila)
Domestic Rabbit(100357208) tribbles homolog 2 (Drosophila)
Zebrafish(100331041) tribbles homolog 2 (Drosophila)
dog(403884) tribbles homolog 2 (Drosophila)
domestic cat(101085367) tribbles homolog 2 (Drosophila)
chicken(378919) tribbles homolog 2 (Drosophila)
191 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_144551 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_144551 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_144551 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021643 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021643 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021643 MISSION® shRNA Lentiviral Transduction Particles human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021643 Rosetta Predictions human pricing
NM_001108015 Rosetta Predictions rat pricing
NM_144551 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021643 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00121517 predicted 2539
2 SASI_Hs01_00121518 predicted 1782
3 SASI_Hs01_00121519 predicted 2475
4 SASI_Hs01_00121520 predicted 1806
5 SASI_Hs01_00121521 predicted 1769
6 SASI_Hs01_00121522 predicted 1860
7 SASI_Hs02_00355010 predicted 2239
8 SASI_Hs01_00121524 predicted 2381
9 SASI_Hs01_00121525 predicted 2394
10 SASI_Hs02_00355011 predicted 1612
11 SASI_Hs01_00121523 predicted 1765
12 SASI_Hs01_00121526 predicted 2349
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001108015 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn02_00234525 predicted 571
2 SASI_Rn02_00234526 predicted 340
3 SASI_Rn02_00234527 predicted 307
4 SASI_Rn02_00234528 predicted 774
5 SASI_Rn02_00234529 predicted 936
6 SASI_Rn02_00234530 predicted 544
7 SASI_Rn02_00234531 predicted 954
8 SASI_Rn02_00234532 predicted 899
9 SASI_Rn02_00234533 predicted 427
10 SASI_Rn02_00234534 predicted 943
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144551 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00198849 predicted 1816
2 SASI_Mm01_00198850 predicted 1820
3 SASI_Mm01_00198851 predicted 1693
4 SASI_Mm02_00340089 predicted 2086
5 SASI_Mm01_00198852 predicted 1603
6 SASI_Mm01_00198853 predicted 1660
7 SASI_Mm01_00198854 predicted 1860
8 SASI_Mm01_00198855 predicted 1931
9 SASI_Mm01_00198856 predicted 2050
10 SASI_Mm01_00198857 predicted 2399
11 SASI_Mm01_00198848 predicted 2409
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_144551
TRIB2 MISSION shRNA Bacterial Glycerol Stock
tribbles homolog 2 (Drosophila)
Mouse
8 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000024214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144551.3-824s1c1
Sequence:CCGGCCATAGCAACATCAACCAAATCTCGAGATTTGGTTGATGTTGCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144551.3-1032s1c1
Sequence:CCGGCGGAAATTTATCTTCAAGGATCTCGAGATCCTTGAAGATAAATTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144551.3-1434s1c1
Sequence:CCGGAGTGTCTCAAATTCGGGATTTCTCGAGAAATCCCGAATTTGAGACACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144551.3-667s1c1
Sequence:CCGGGCGTTTCTTGCATCGGGAAATCTCGAGATTTCCCGATGCAAGAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144551.3-1248s1c1
Sequence:CCGGCGTTACCCTTTCCATGACATTCTCGAGAATGTCATGGAAAGGGTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144551.5-1808s21c1
Sequence:CCGGGACCTCAAGCTGCGGAAATTTCTCGAGAAATTTCCGCAGCTTGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144551.5-2675s21c1
Sequence:CCGGGCATTGCACTGTTAGCATTTACTCGAGTAAATGCTAACAGTGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000361999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144551.5-1355s21c1
Sequence:CCGGTTCGAAGAGCTGTCGTCTATACTCGAGTATAGACGACAGCTCTTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_144551
TRIB2 MISSION shRNA shRNA Plasmid DNA
tribbles homolog 2 (Drosophila)
Mouse
8 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000024214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144551.3-824s1c1
Sequence:CCGGCCATAGCAACATCAACCAAATCTCGAGATTTGGTTGATGTTGCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144551.3-1032s1c1
Sequence:CCGGCGGAAATTTATCTTCAAGGATCTCGAGATCCTTGAAGATAAATTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144551.3-1434s1c1
Sequence:CCGGAGTGTCTCAAATTCGGGATTTCTCGAGAAATCCCGAATTTGAGACACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144551.3-667s1c1
Sequence:CCGGGCGTTTCTTGCATCGGGAAATCTCGAGATTTCCCGATGCAAGAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144551.3-1248s1c1
Sequence:CCGGCGTTACCCTTTCCATGACATTCTCGAGAATGTCATGGAAAGGGTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144551.5-1808s21c1
Sequence:CCGGGACCTCAAGCTGCGGAAATTTCTCGAGAAATTTCCGCAGCTTGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144551.5-2675s21c1
Sequence:CCGGGCATTGCACTGTTAGCATTTACTCGAGTAAATGCTAACAGTGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000361999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144551.5-1355s21c1
Sequence:CCGGTTCGAAGAGCTGTCGTCTATACTCGAGTATAGACGACAGCTCTTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_144551
TRIB2 MISSION shRNA Lentiviral Transduction Particles
tribbles homolog 2 (Drosophila)
Mouse
8 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000024214    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144551.3-824s1c1
Sequence:CCGGCCATAGCAACATCAACCAAATCTCGAGATTTGGTTGATGTTGCTATGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024216    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144551.3-1032s1c1
Sequence:CCGGCGGAAATTTATCTTCAAGGATCTCGAGATCCTTGAAGATAAATTTCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024218    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144551.3-1434s1c1
Sequence:CCGGAGTGTCTCAAATTCGGGATTTCTCGAGAAATCCCGAATTTGAGACACTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024217    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144551.3-667s1c1
Sequence:CCGGGCGTTTCTTGCATCGGGAAATCTCGAGATTTCCCGATGCAAGAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024215    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_144551.3-1248s1c1
Sequence:CCGGCGTTACCCTTTCCATGACATTCTCGAGAATGTCATGGAAAGGGTAACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362066    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144551.5-1808s21c1
Sequence:CCGGGACCTCAAGCTGCGGAAATTTCTCGAGAAATTTCCGCAGCTTGAGGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362058    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_144551.5-2675s21c1
Sequence:CCGGGCATTGCACTGTTAGCATTTACTCGAGTAAATGCTAACAGTGCAATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000361999    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_144551.5-1355s21c1
Sequence:CCGGTTCGAAGAGCTGTCGTCTATACTCGAGTATAGACGACAGCTCTTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021643
VALIDATED
TRIB2 MISSION shRNA Bacterial Glycerol Stock
tribbles homolog 2 (Drosophila)
Human
10 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000007142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_021643.1-3782s1c1
Sequence:CCGGCGTGGACTCTAGTATGTAAATCTCGAGATTTACATACTAGAGTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_021643.1-1395s1c1
Sequence:CCGGGCGTTTCTTGTATCGGGAAATCTCGAGATTTCCCGATACAAGAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_021643.1-2218s1c1
Sequence:CCGGCGTCAACATGGAAGAGAACTTCTCGAGAAGTTCTCTTCCATGTTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021643.1-1756s1c1
Sequence:CCGGGCTGCGGAAATTCATCTTTAACTCGAGTTAAAGATGAATTTCCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021643.1-1550s1c1
Sequence:CCGGGCTCATAGTAACATCAACCAACTCGAGTTGGTTGATGTTACTATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021643.1-1748s1c1
Sequence:CCGGGACCTCAAGCTGCGGAAATTCCTCGAGGAATTTCCGCAGCTTGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021643.1-2228s1c1
Sequence:CCGGGAAGAGAACTTGGACCCTTTCCTCGAGGAAAGGGTCCAAGTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021643.3-2913s21c1
Sequence:CCGGCAACCACCTAGCTGGTAATTACTCGAGTAATTACCAGCTAGGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021643.3-2830s21c1
Sequence:CCGGGCATCGCACTGTTAGCATTTACTCGAGTAAATGCTAACAGTGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000356138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021643.3-1506s21c1
Sequence:CCGGTTCGAAGAGTTGTCGTCTATACTCGAGTATAGACGACAACTCTTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021643
VALIDATED
TRIB2 MISSION shRNA shRNA Plasmid DNA
tribbles homolog 2 (Drosophila)
Human
10 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000007142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_021643.1-3782s1c1
Sequence:CCGGCGTGGACTCTAGTATGTAAATCTCGAGATTTACATACTAGAGTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_021643.1-1395s1c1
Sequence:CCGGGCGTTTCTTGTATCGGGAAATCTCGAGATTTCCCGATACAAGAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_021643.1-2218s1c1
Sequence:CCGGCGTCAACATGGAAGAGAACTTCTCGAGAAGTTCTCTTCCATGTTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021643.1-1756s1c1
Sequence:CCGGGCTGCGGAAATTCATCTTTAACTCGAGTTAAAGATGAATTTCCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021643.1-1550s1c1
Sequence:CCGGGCTCATAGTAACATCAACCAACTCGAGTTGGTTGATGTTACTATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021643.1-1748s1c1
Sequence:CCGGGACCTCAAGCTGCGGAAATTCCTCGAGGAATTTCCGCAGCTTGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021643.1-2228s1c1
Sequence:CCGGGAAGAGAACTTGGACCCTTTCCTCGAGGAAAGGGTCCAAGTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021643.3-2913s21c1
Sequence:CCGGCAACCACCTAGCTGGTAATTACTCGAGTAATTACCAGCTAGGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021643.3-2830s21c1
Sequence:CCGGGCATCGCACTGTTAGCATTTACTCGAGTAAATGCTAACAGTGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000356138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021643.3-1506s21c1
Sequence:CCGGTTCGAAGAGTTGTCGTCTATACTCGAGTATAGACGACAACTCTTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021643
VALIDATED
TRIB2 MISSION shRNA Lentiviral Transduction Particles
tribbles homolog 2 (Drosophila)
Human
10 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000007142    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: A3
TRC Version: 1 Clone ID:NM_021643.1-3782s1c1
Sequence:CCGGCGTGGACTCTAGTATGTAAATCTCGAGATTTACATACTAGAGTCCACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007145    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.91 Cell Line: A3
TRC Version: 1 Clone ID:NM_021643.1-1395s1c1
Sequence:CCGGGCGTTTCTTGTATCGGGAAATCTCGAGATTTCCCGATACAAGAAACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007146    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: A3
TRC Version: 1 Clone ID:NM_021643.1-2218s1c1
Sequence:CCGGCGTCAACATGGAAGAGAACTTCTCGAGAAGTTCTCTTCCATGTTGACGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007144    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021643.1-1756s1c1
Sequence:CCGGGCTGCGGAAATTCATCTTTAACTCGAGTTAAAGATGAATTTCCGCAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007143    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_021643.1-1550s1c1
Sequence:CCGGGCTCATAGTAACATCAACCAACTCGAGTTGGTTGATGTTACTATGAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199912    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021643.1-1748s1c1
Sequence:CCGGGACCTCAAGCTGCGGAAATTCCTCGAGGAATTTCCGCAGCTTGAGGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196978    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_021643.1-2228s1c1
Sequence:CCGGGAAGAGAACTTGGACCCTTTCCTCGAGGAAAGGGTCCAAGTTCTCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356137    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021643.3-2913s21c1
Sequence:CCGGCAACCACCTAGCTGGTAATTACTCGAGTAATTACCAGCTAGGTGGTTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356139    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021643.3-2830s21c1
Sequence:CCGGGCATCGCACTGTTAGCATTTACTCGAGTAAATGCTAACAGTGCGATGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000356138    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021643.3-1506s21c1
Sequence:CCGGTTCGAAGAGTTGTCGTCTATACTCGAGTATAGACGACAACTCTTCGAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks