EMAIL THIS PAGE TO A FRIEND

TRIB3

tribbles homolog 3 (Drosophila)

Synonyms: C20orf97 NIPK SINK SKIP3 TRB3
Gene ID:
Human(57761) Summary: The protein encoded by this gene is a putative protein kinase that is induced by the transcription factor NF-kappaB. The encoded protein is a negative regulator of NF-kappaB and can also sensitize cells to TNF- and TRAIL-induced apoptosis. In addition, this protein can negatively regulate the cell survival serine-threonine kinase AKT1. [provided by RefSeq, Jul 2008]
Mouse(228775) tribbles homolog 3 (Drosophila)
Rat(246273) tribbles homolog 3 (Drosophila)
Zebrafish(405805) tribbles homolog 3 (Drosophila)
domestic cat(101083255) tribbles homolog 3 (Drosophila)
dog(485819) tribbles homolog 3 (Drosophila)
naked mole-rat(101716331) tribbles homolog 3 (Drosophila)
domestic guinea pig(100712861) tribbles homolog 3 (Drosophila)
cow(538465) tribbles homolog 3 (Drosophila)
sheep(101122616) tribbles homolog 3 (Drosophila)
135 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

Antibodies

Product # Description Species Reactivity Application Add to Cart
 
SAB1302068 ANTI-MOUSE TRIB3 (C-TERM) antibody produced in rabbit IgG fraction of antiserum, buffered aqueous solution mouse
western blot pricing
T8076 Anti-TRB3 (N-terminal) antibody produced in rabbit affinity isolated antibody, buffered aqueous solution human
western blot pricing
SAB1407812 Anti-TRIB3 antibody produced in mouse purified immunoglobulin, buffered aqueous solution human
western blot pricing
HPA015272 Anti-TRIB3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody, buffered aqueous glycerol solution human
immunofluorescence, immunohistochemistry, western blot pricing
SAB1411157 Anti-TRIB3 antibody produced in rabbit purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
HPA055442 Anti-TRIB3 antibody produced in rabbit Prestige Antibodies® Powered by Atlas Antibodies, affinity isolated antibody New human
immunofluorescence pricing
WH0057761M3 Monoclonal Anti-TRIB3 antibody produced in mouse clone 1H2, purified immunoglobulin, buffered aqueous solution human
ELISA, immunofluorescence, western blot pricing
SAB1405226 Monoclonal Anti-TRIB3 antibody produced in mouse clone 2F7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing
SAB1409582 Monoclonal Anti-TRIB3 antibody produced in mouse clone 3D7, purified immunoglobulin, buffered aqueous solution human
ELISA, western blot pricing

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_175093 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_175093 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_175093 MISSION® shRNA Lentiviral Transduction Particles mouse pricing
SHCLNG-NM_021158 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_021158 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_021158 MISSION® shRNA Lentiviral Transduction Particles human pricing

esiRNA

Product # Description Species Add to Cart
 
EHU013881 MISSION® esiRNA esiRNA targeting human TRIB3 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_021158 Rosetta Predictions human pricing
NM_144755 Rosetta Predictions rat pricing
NM_144554 Rosetta Predictions mouse pricing
NM_175093 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_021158 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00197510 predicted 945
2 SASI_Hs01_00197511 predicted 761
3 SASI_Hs01_00197512 predicted 1136
4 SASI_Hs01_00197513 predicted 1056
5 SASI_Hs01_00197514 predicted 1172
6 SASI_Hs01_00197515 predicted 1294
7 SASI_Hs01_00197516 predicted 2078
8 SASI_Hs02_00354701 predicted 1204
9 SASI_Hs01_00197517 predicted 1034
10 SASI_Hs02_00354702 predicted 1447
11 SASI_Hs01_00197518 predicted 1673
12 SASI_Hs01_00197519 predicted 1979
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144755 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00095017 predicted 299
2 SASI_Rn01_00095018 predicted 702
3 SASI_Rn02_00268643 predicted 205
4 SASI_Rn01_00095019 predicted 424
5 SASI_Rn01_00095020 predicted 242
6 SASI_Rn01_00095021 predicted 1057
7 SASI_Rn01_00095022 predicted 822
8 SASI_Rn01_00095023 predicted 242
9 SASI_Rn01_00095024 predicted 715
10 SASI_Rn01_00095025 predicted 759
11 SASI_Rn01_00095026 predicted 1142
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_144554 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00043611 predicted 335
2 SASI_Mm01_00043612 predicted 251
3 SASI_Mm01_00043613 predicted 224
4 SASI_Mm01_00043614 predicted 238
5 SASI_Mm01_00043615 predicted 254
6 SASI_Mm01_00043616 predicted 228
7 SASI_Mm01_00043617 predicted 332
8 SASI_Mm01_00043618 predicted 237
9 SASI_Mm01_00043619 predicted 324
10 SASI_Mm01_00043620 predicted 232
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_175093 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm02_00345676 predicted 1373
2 SASI_Mm01_00122585 predicted 240
3 SASI_Mm02_00345677 predicted 1350
4 SASI_Mm02_00345678 predicted 1445
5 SASI_Mm02_00345679 predicted 1093
6 SASI_Mm02_00345680 predicted 1102
7 SASI_Mm02_00345681 predicted 726
8 SASI_Mm02_00345682 predicted 233
9 SASI_Mm02_00345683 predicted 1616
10 SASI_Mm02_00345684 predicted 809
11 SASI_Mm01_00122583 predicted 348
12 SASI_Mm01_00122584 predicted 260
13 SASI_Mm01_00122586 predicted 243
14 SASI_Mm01_00122587 predicted 261
15 SASI_Mm01_00122588 predicted 239
16 SASI_Mm01_00122589 predicted 331
17 SASI_Mm01_00122590 predicted 240
18 SASI_Mm01_00122591 predicted 335
19 SASI_Mm01_00122592 predicted 236
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_175093
VALIDATED
TRIB3 MISSION shRNA Bacterial Glycerol Stock
tribbles homolog 3 (Drosophila)
Mouse
13 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000362180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175093.2-977s21c1
Sequence:CCGGGATACCCATTCCACGACTCTGCTCGAGCAGAGTCGTGGAATGGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175093.2-282s21c1
Sequence:CCGGTGCCAAGTGTCCAGTCCTAAACTCGAGTTTAGGACTGGACACTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175093.2-759s21c1
Sequence:CCGGGCGTCGCTTTGTCTTCAGCAACTCGAGTTGCTGAAGACAAAGCGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175093.2-1098s21c1
Sequence:CCGGGGAACCTTCAGAGCGACTTGTCTCGAGACAAGTCGCTCTGAAGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175093.2-1019s21c1
Sequence:CCGGAGATCCGTAGAGGGACCTTTGCTCGAGCAAAGGTCCCTCTACGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000276731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175093.2-1685s21c1
Sequence:CCGGATGTGCCTCAGGACCACAAATCTCGAGATTTGTGGTCCTGAGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175093.2-259s21c1
Sequence:CCGGTTGGAGTTTGATGACAATATTCTCGAGAATATTGTCATCAAACTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000362104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175093.2-1340s21c1
Sequence:CCGGTTGGGCCAAGCTAAACCTTAACTCGAGTTAAGGTTTAGCTTGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175093.1-233s1c1
Sequence:CCGGCCGTTGGAGTTTGATGACAATCTCGAGATTGTCATCAAACTCCAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175093.1-736s1c1
Sequence:CCGGGCGTCGCTTTGTCTTCAGCAACTCGAGTTGCTGAAGACAAAGCGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175093.1-569s1c1
Sequence:CCGGTCTCGGCTCCTTTACATCTTTCTCGAGAAAGATGTAAAGGAGCCGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175093.1-457s1c1
Sequence:CCGGAGAGTACACCTGCAAGGTGTACTCGAGTACACCTTGCAGGTGTACTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000024228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175093.1-787s1c1
Sequence:CCGGCCTGGAAGATGCCTGCGTGATCTCGAGATCACGCAGGCATCTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_175093
VALIDATED
TRIB3 MISSION shRNA shRNA Plasmid DNA
tribbles homolog 3 (Drosophila)
Mouse
13 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000362180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175093.2-977s21c1
Sequence:CCGGGATACCCATTCCACGACTCTGCTCGAGCAGAGTCGTGGAATGGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175093.2-282s21c1
Sequence:CCGGTGCCAAGTGTCCAGTCCTAAACTCGAGTTTAGGACTGGACACTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175093.2-759s21c1
Sequence:CCGGGCGTCGCTTTGTCTTCAGCAACTCGAGTTGCTGAAGACAAAGCGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175093.2-1098s21c1
Sequence:CCGGGGAACCTTCAGAGCGACTTGTCTCGAGACAAGTCGCTCTGAAGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175093.2-1019s21c1
Sequence:CCGGAGATCCGTAGAGGGACCTTTGCTCGAGCAAAGGTCCCTCTACGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000276731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175093.2-1685s21c1
Sequence:CCGGATGTGCCTCAGGACCACAAATCTCGAGATTTGTGGTCCTGAGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175093.2-259s21c1
Sequence:CCGGTTGGAGTTTGATGACAATATTCTCGAGAATATTGTCATCAAACTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000362104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175093.2-1340s21c1
Sequence:CCGGTTGGGCCAAGCTAAACCTTAACTCGAGTTAAGGTTTAGCTTGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175093.1-233s1c1
Sequence:CCGGCCGTTGGAGTTTGATGACAATCTCGAGATTGTCATCAAACTCCAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175093.1-736s1c1
Sequence:CCGGGCGTCGCTTTGTCTTCAGCAACTCGAGTTGCTGAAGACAAAGCGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175093.1-569s1c1
Sequence:CCGGTCTCGGCTCCTTTACATCTTTCTCGAGAAAGATGTAAAGGAGCCGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175093.1-457s1c1
Sequence:CCGGAGAGTACACCTGCAAGGTGTACTCGAGTACACCTTGCAGGTGTACTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000024228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175093.1-787s1c1
Sequence:CCGGCCTGGAAGATGCCTGCGTGATCTCGAGATCACGCAGGCATCTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_175093
VALIDATED
TRIB3 MISSION shRNA Lentiviral Transduction Particles
tribbles homolog 3 (Drosophila)
Mouse
13 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000362180    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175093.2-977s21c1
Sequence:CCGGGATACCCATTCCACGACTCTGCTCGAGCAGAGTCGTGGAATGGGTATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276730    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175093.2-282s21c1
Sequence:CCGGTGCCAAGTGTCCAGTCCTAAACTCGAGTTTAGGACTGGACACTTGGCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276666    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175093.2-759s21c1
Sequence:CCGGGCGTCGCTTTGTCTTCAGCAACTCGAGTTGCTGAAGACAAAGCGACGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276669    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175093.2-1098s21c1
Sequence:CCGGGGAACCTTCAGAGCGACTTGTCTCGAGACAAGTCGCTCTGAAGGTTCCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276667    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175093.2-1019s21c1
Sequence:CCGGAGATCCGTAGAGGGACCTTTGCTCGAGCAAAGGTCCCTCTACGGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000276731    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175093.2-1685s21c1
Sequence:CCGGATGTGCCTCAGGACCACAAATCTCGAGATTTGTGGTCCTGAGGCACATTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362103    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_175093.2-259s21c1
Sequence:CCGGTTGGAGTTTGATGACAATATTCTCGAGAATATTGTCATCAAACTCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000362104    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_175093.2-1340s21c1
Sequence:CCGGTTGGGCCAAGCTAAACCTTAACTCGAGTTAAGGTTTAGCTTGGCCCAATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024224    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.56 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175093.1-233s1c1
Sequence:CCGGCCGTTGGAGTTTGATGACAATCTCGAGATTGTCATCAAACTCCAACGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024225    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175093.1-736s1c1
Sequence:CCGGGCGTCGCTTTGTCTTCAGCAACTCGAGTTGCTGAAGACAAAGCGACGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024226    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.51 Cell Line: Hepa 1-6
TRC Version: 1 Clone ID:NM_175093.1-569s1c1
Sequence:CCGGTCTCGGCTCCTTTACATCTTTCTCGAGAAAGATGTAAAGGAGCCGAGATTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024227    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175093.1-457s1c1
Sequence:CCGGAGAGTACACCTGCAAGGTGTACTCGAGTACACCTTGCAGGTGTACTCTTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000024228    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_175093.1-787s1c1
Sequence:CCGGCCTGGAAGATGCCTGCGTGATCTCGAGATCACGCAGGCATCTTCCAGGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_021158
VALIDATED
TRIB3 MISSION shRNA Bacterial Glycerol Stock
tribbles homolog 3 (Drosophila)
Human
14 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000307989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_021158.3-2203s21c1
Sequence:CCGGGCTAGTTCTTGTCTAACTCAACTCGAGTTGAGTTAGACAAGAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021158.3-2375s21c1
Sequence:CCGGCCAGGTCCATACTCTAGGTTTCTCGAGAAACCTAGAGTATGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_021158.3-1050s21c1
Sequence:CCGGGATCTCAAGCTGTGTCGCTTTCTCGAGAAAGCGACACAGCTTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000295920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021158.3-984s21c1
Sequence:CCGGGCCGTGCTCTTCCGCCAGATGCTCGAGCATCTGGCGGAAGAGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000298754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_021158.3-568s21c1
Sequence:CCGGTGGATGACAACTTAGATACCGCTCGAGCGGTATCTAAGTTGTCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_021158.3-667s1c1
Sequence:CCGGCTGCTCCAGATCGTGCAACTGCTCGAGCAGTTGCACGATCTGGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_021158.3-984s1c1
Sequence:CCGGGCCGTGCTCTTCCGCCAGATGCTCGAGCATCTGGCGGAAGAGCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000199148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_021158.3-1475s1c1
Sequence:CCGGCCCAACCCGATCCCATCTCTGCTCGAGCAGAGATGGGATCGGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000196756    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021158.3-2203s1c1
Sequence:CCGGGCTAGTTCTTGTCTAACTCAACTCGAGTTGAGTTAGACAAGAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000197212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021158.3-1050s1c1
Sequence:CCGGGATCTCAAGCTGTGTCGCTTTCTCGAGAAAGCGACACAGCTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037404    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021158.3-2409s1c1
Sequence:CCGGCCAGGTCCATACTCTAGGTTTCTCGAGAAACCTAGAGTATGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037405    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_021158.3-607s1c1
Sequence:CCGGGACAACTTAGATACCGAGCGTCTCGAGACGCTCGGTATCTAAGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037408    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_021158.3-602s1c1
Sequence:CCGGTGGATGACAACTTAGATACCGCTCGAGCGGTATCTAAGTTGTCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000037406    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_021158.3-608s1c1
Sequence:CCGGACAACTTAGATACCGAGCGTCCTCGAGGACGCTCGGTATCTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_021158
VALIDATED
TRIB3 MISSION shRNA shRNA Plasmid DNA
tribbles homolog 3 (Drosophila)
Human
14 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000307989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_021158.3-2203s21c1
Sequence:CCGGGCTAGTTCTTGTCTAACTCAACTCGAGTTGAGTTAGACAAGAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021158.3-2375s21c1
Sequence:CCGGCCAGGTCCATACTCTAGGTTTCTCGAGAAACCTAGAGTATGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_021158.3-1050s21c1
Sequence:CCGGGATCTCAAGCTGTGTCGCTTTCTCGAGAAAGCGACACAGCTTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000295920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021158.3-984s21c1
Sequence:CCGGGCCGTGCTCTTCCGCCAGATGCTCGAGCATCTGGCGGAAGAGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000298754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_021158.3-568s21c1
Sequence:CCGGTGGATGACAACTTAGATACCGCTCGAGCGGTATCTAAGTTGTCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_021158.3-667s1c1
Sequence:CCGGCTGCTCCAGATCGTGCAACTGCTCGAGCAGTTGCACGATCTGGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_021158.3-984s1c1
Sequence:CCGGGCCGTGCTCTTCCGCCAGATGCTCGAGCATCTGGCGGAAGAGCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000199148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_021158.3-1475s1c1
Sequence:CCGGCCCAACCCGATCCCATCTCTGCTCGAGCAGAGATGGGATCGGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000196756    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021158.3-2203s1c1
Sequence:CCGGGCTAGTTCTTGTCTAACTCAACTCGAGTTGAGTTAGACAAGAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000197212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021158.3-1050s1c1
Sequence:CCGGGATCTCAAGCTGTGTCGCTTTCTCGAGAAAGCGACACAGCTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037404    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021158.3-2409s1c1
Sequence:CCGGCCAGGTCCATACTCTAGGTTTCTCGAGAAACCTAGAGTATGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037405    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_021158.3-607s1c1
Sequence:CCGGGACAACTTAGATACCGAGCGTCTCGAGACGCTCGGTATCTAAGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037408    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_021158.3-602s1c1
Sequence:CCGGTGGATGACAACTTAGATACCGCTCGAGCGGTATCTAAGTTGTCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000037406    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_021158.3-608s1c1
Sequence:CCGGACAACTTAGATACCGAGCGTCCTCGAGGACGCTCGGTATCTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_021158
VALIDATED
TRIB3 MISSION shRNA Lentiviral Transduction Particles
tribbles homolog 3 (Drosophila)
Human
14 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000307989    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 2 Clone ID:NM_021158.3-2203s21c1
Sequence:CCGGGCTAGTTCTTGTCTAACTCAACTCGAGTTGAGTTAGACAAGAACTAGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298755    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_021158.3-2375s21c1
Sequence:CCGGCCAGGTCCATACTCTAGGTTTCTCGAGAAACCTAGAGTATGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295919    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.94 Cell Line: A549
TRC Version: 2 Clone ID:NM_021158.3-1050s21c1
Sequence:CCGGGATCTCAAGCTGTGTCGCTTTCTCGAGAAAGCGACACAGCTTGAGATCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000295920    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_021158.3-984s21c1
Sequence:CCGGGCCGTGCTCTTCCGCCAGATGCTCGAGCATCTGGCGGAAGAGCACGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000298754    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.64 Cell Line: A549
TRC Version: 2 Clone ID:NM_021158.3-568s21c1
Sequence:CCGGTGGATGACAACTTAGATACCGCTCGAGCGGTATCTAAGTTGTCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199844    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_021158.3-667s1c1
Sequence:CCGGCTGCTCCAGATCGTGCAACTGCTCGAGCAGTTGCACGATCTGGAGCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199684    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.78 Cell Line: A549
TRC Version: 1 Clone ID:NM_021158.3-984s1c1
Sequence:CCGGGCCGTGCTCTTCCGCCAGATGCTCGAGCATCTGGCGGAAGAGCACGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000199148    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.69 Cell Line: A549
TRC Version: 1 Clone ID:NM_021158.3-1475s1c1
Sequence:CCGGCCCAACCCGATCCCATCTCTGCTCGAGCAGAGATGGGATCGGGTTGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000196756    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.97 Cell Line: A549
TRC Version: 1 Clone ID:NM_021158.3-2203s1c1
Sequence:CCGGGCTAGTTCTTGTCTAACTCAACTCGAGTTGAGTTAGACAAGAACTAGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000197212    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.92 Cell Line: A549
TRC Version: 1 Clone ID:NM_021158.3-1050s1c1
Sequence:CCGGGATCTCAAGCTGTGTCGCTTTCTCGAGAAAGCGACACAGCTTGAGATCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037404    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.73 Cell Line: A549
TRC Version: 1 Clone ID:NM_021158.3-2409s1c1
Sequence:CCGGCCAGGTCCATACTCTAGGTTTCTCGAGAAACCTAGAGTATGGACCTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037405    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_021158.3-607s1c1
Sequence:CCGGGACAACTTAGATACCGAGCGTCTCGAGACGCTCGGTATCTAAGTTGTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037408    
Product Details
Validated
Region:UNK Mean KnockDown Level: 0.72 Cell Line: A549
TRC Version: 1 Clone ID:NM_021158.3-602s1c1
Sequence:CCGGTGGATGACAACTTAGATACCGCTCGAGCGGTATCTAAGTTGTCATCCATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000037406    
Product Details

Region:UNK
TRC Version: 1 Clone ID:NM_021158.3-608s1c1
Sequence:CCGGACAACTTAGATACCGAGCGTCCTCGAGGACGCTCGGTATCTAAGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks