EMAIL THIS PAGE TO A FRIEND

TRIL

TLR4 interactor with leucine-rich repeats

UniProtKB ID: Q7L0X0, A4D1A6, O75139
Gene ID:
Human(9865) Summary: TRIL is a component of the TLR4 (MIM 603030) complex and is induced in a number of cell types by lipopolysaccharide (LPS) (Carpenter et al., 2009 [PubMed 19710467]
Mouse(66873) TLR4 interactor with leucine-rich repeats
Rat(362364) TLR4 interactor with leucine-rich repeats
cow(782880) TLR4 interactor with leucine-rich repeats
sheep(101112725) TLR4 interactor with leucine-rich repeats
cow(518003) TLR4 interactor with leucine-rich repeats
domestic guinea pig(100718203) TLR4 interactor with leucine-rich repeats
chicken(428436) TLR4 interactor with leucine-rich repeats
dog(482378) TLR4 interactor with leucine-rich repeats
domestic cat(101085452) TLR4 interactor with leucine-rich repeats
90 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_014817 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_014817 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_014817 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_025817 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_025817 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_025817 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EMU212211 MISSION® esiRNA esiRNA targeting mouse Tril mouse pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_014817 Rosetta Predictions human pricing
NM_001034010 Rosetta Predictions rat pricing
NM_025817 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_014817 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00033239 predicted 2093
2 SASI_Hs01_00033240 predicted 1509
3 SASI_Hs01_00033241 predicted 477
4 SASI_Hs01_00033242 predicted 1554
5 SASI_Hs01_00033243 predicted 2966
6 SASI_Hs01_00033244 predicted 1887
7 SASI_Hs01_00033245 predicted 892
8 SASI_Hs01_00033246 predicted 2963
9 SASI_Hs01_00033247 predicted 750
10 SASI_Hs01_00033248 predicted 2097
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001034010 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00054828 predicted 1215
2 SASI_Rn01_00054829 predicted 1367
3 SASI_Rn01_00054830 predicted 553
4 SASI_Rn01_00054831 predicted 2877
5 SASI_Rn01_00054832 predicted 1074
6 SASI_Rn01_00054833 predicted 2787
7 SASI_Rn01_00054834 predicted 707
8 SASI_Rn01_00054836 predicted 775
9 SASI_Rn02_00203888 predicted 745
10 SASI_Rn02_00203889 predicted 2836
11 SASI_Rn01_00054835 predicted 572
12 SASI_Rn01_00054837 predicted 2900
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_025817 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00123382 predicted 1655
2 SASI_Mm01_00123383 predicted 1503
3 SASI_Mm01_00123385 predicted 3071
4 SASI_Mm01_00123386 predicted 1370
5 SASI_Mm01_00123387 predicted 1000
6 SASI_Mm01_00123388 predicted 3019
7 SASI_Mm01_00123389 predicted 1518
8 SASI_Mm01_00123390 predicted 1015
9 SASI_Mm02_00329066 predicted 3099
10 SASI_Mm02_00329067 predicted 1643
11 SASI_Mm01_00123384 predicted 564
12 SASI_Mm01_00123391 predicted 1147
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_014817
TRIL MISSION shRNA Bacterial Glycerol Stock
TLR4 interactor with leucine-rich repeats
Human
7 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000148264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014817.2-475s1c1
Sequence:CCGGGCAACTTCATAACCAACATCACTCGAGTGATGTTGGTTATGAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000146946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014817.2-2018s1c1
Sequence:CCGGCAACAAGTTCATTCTGTGCAACTCGAGTTGCACAGAATGAACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000183073    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014817.2-3429s1c1
Sequence:CCGGCGAGGATAACTAAGATTACATCTCGAGATGTAATCTTAGTTATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014817.2-2006s1c1
Sequence:CCGGCCCATGCGACTTCAACAAGTTCTCGAGAACTTGTTGAAGTCGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000181059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014817.2-482s1c1
Sequence:CCGGCATAACCAACATCACGGCCTTCTCGAGAAGGCCGTGATGTTGGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000448064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014817.3-3215s21c1
Sequence:CCGGGAAGGAACTTATTACCATTACCTCGAGGTAATGGTAATAAGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000441554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014817.3-2798s21c1
Sequence:CCGGGACTAGGTCCAGGGCATATAGCTCGAGCTATATGCCCTGGACCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_014817
TRIL MISSION shRNA shRNA Plasmid DNA
TLR4 interactor with leucine-rich repeats
Human
7 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000148264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014817.2-475s1c1
Sequence:CCGGGCAACTTCATAACCAACATCACTCGAGTGATGTTGGTTATGAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000146946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014817.2-2018s1c1
Sequence:CCGGCAACAAGTTCATTCTGTGCAACTCGAGTTGCACAGAATGAACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000183073    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014817.2-3429s1c1
Sequence:CCGGCGAGGATAACTAAGATTACATCTCGAGATGTAATCTTAGTTATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014817.2-2006s1c1
Sequence:CCGGCCCATGCGACTTCAACAAGTTCTCGAGAACTTGTTGAAGTCGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000181059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014817.2-482s1c1
Sequence:CCGGCATAACCAACATCACGGCCTTCTCGAGAAGGCCGTGATGTTGGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000448064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014817.3-3215s21c1
Sequence:CCGGGAAGGAACTTATTACCATTACCTCGAGGTAATGGTAATAAGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000441554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014817.3-2798s21c1
Sequence:CCGGGACTAGGTCCAGGGCATATAGCTCGAGCTATATGCCCTGGACCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_014817
TRIL MISSION shRNA Lentiviral Transduction Particles
TLR4 interactor with leucine-rich repeats
Human
7 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000148264    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014817.2-475s1c1
Sequence:CCGGGCAACTTCATAACCAACATCACTCGAGTGATGTTGGTTATGAAGTTGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000146946    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014817.2-2018s1c1
Sequence:CCGGCAACAAGTTCATTCTGTGCAACTCGAGTTGCACAGAATGAACTTGTTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000183073    
Product Details

Region:3UTR
TRC Version: 1.5 Clone ID:NM_014817.2-3429s1c1
Sequence:CCGGCGAGGATAACTAAGATTACATCTCGAGATGTAATCTTAGTTATCCTCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181029    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014817.2-2006s1c1
Sequence:CCGGCCCATGCGACTTCAACAAGTTCTCGAGAACTTGTTGAAGTCGCATGGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000181059    
Product Details

Region:CDS
TRC Version: 1.5 Clone ID:NM_014817.2-482s1c1
Sequence:CCGGCATAACCAACATCACGGCCTTCTCGAGAAGGCCGTGATGTTGGTTATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000448064    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_014817.3-3215s21c1
Sequence:CCGGGAAGGAACTTATTACCATTACCTCGAGGTAATGGTAATAAGTTCCTTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000441554    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_014817.3-2798s21c1
Sequence:CCGGGACTAGGTCCAGGGCATATAGCTCGAGCTATATGCCCTGGACCTAGTCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_025817
VALIDATED
TRIL MISSION shRNA Bacterial Glycerol Stock
TLR4 interactor with leucine-rich repeats
Mouse
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000202144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025817.3-567s1c1
Sequence:CCGGCCAACATCTCCTATGCACCAACTCGAGTTGGTGCATAGGAGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025817.3-1660s1c1
Sequence:CCGGCTGGATTACCTGGATGACCAACTCGAGTTGGTCATCCAGGTAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000201250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025817.3-4253s1c1
Sequence:CCGGGCCAGTATCTTACTGTGTTATCTCGAGATAACACAGTAAGATACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000191275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025817.3-4254s1c1
Sequence:CCGGCCAGTATCTTACTGTGTTATTCTCGAGAATAACACAGTAAGATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000190255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025817.3-660s1c1
Sequence:CCGGCGGCAACTTCATCACCAACATCTCGAGATGTTGGTGATGAAGTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025817.3-1660s21c1
Sequence:CCGGCTGGATTACCTGGATGACCAACTCGAGTTGGTCATCCAGGTAATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025817.3-660s21c1
Sequence:CCGGCGGCAACTTCATCACCAACATCTCGAGATGTTGGTGATGAAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025817.3-4253s21c1
Sequence:CCGGGCCAGTATCTTACTGTGTTATCTCGAGATAACACAGTAAGATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000339683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025817.3-567s21c1
Sequence:CCGGCCAACATCTCCTATGCACCAACTCGAGTTGGTGCATAGGAGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_025817
VALIDATED
TRIL MISSION shRNA shRNA Plasmid DNA
TLR4 interactor with leucine-rich repeats
Mouse
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000202144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025817.3-567s1c1
Sequence:CCGGCCAACATCTCCTATGCACCAACTCGAGTTGGTGCATAGGAGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025817.3-1660s1c1
Sequence:CCGGCTGGATTACCTGGATGACCAACTCGAGTTGGTCATCCAGGTAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000201250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025817.3-4253s1c1
Sequence:CCGGGCCAGTATCTTACTGTGTTATCTCGAGATAACACAGTAAGATACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000191275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025817.3-4254s1c1
Sequence:CCGGCCAGTATCTTACTGTGTTATTCTCGAGAATAACACAGTAAGATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000190255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025817.3-660s1c1
Sequence:CCGGCGGCAACTTCATCACCAACATCTCGAGATGTTGGTGATGAAGTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025817.3-1660s21c1
Sequence:CCGGCTGGATTACCTGGATGACCAACTCGAGTTGGTCATCCAGGTAATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025817.3-660s21c1
Sequence:CCGGCGGCAACTTCATCACCAACATCTCGAGATGTTGGTGATGAAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025817.3-4253s21c1
Sequence:CCGGGCCAGTATCTTACTGTGTTATCTCGAGATAACACAGTAAGATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000339683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025817.3-567s21c1
Sequence:CCGGCCAACATCTCCTATGCACCAACTCGAGTTGGTGCATAGGAGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_025817
VALIDATED
TRIL MISSION shRNA Lentiviral Transduction Particles
TLR4 interactor with leucine-rich repeats
Mouse
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000202144    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.82 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025817.3-567s1c1
Sequence:CCGGCCAACATCTCCTATGCACCAACTCGAGTTGGTGCATAGGAGATGTTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201889    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.89 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025817.3-1660s1c1
Sequence:CCGGCTGGATTACCTGGATGACCAACTCGAGTTGGTCATCCAGGTAATCCAGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000201250    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.86 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025817.3-4253s1c1
Sequence:CCGGGCCAGTATCTTACTGTGTTATCTCGAGATAACACAGTAAGATACTGGCTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000191275    
Product Details
Validated
Region:3UTR Mean KnockDown Level: 0.83 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025817.3-4254s1c1
Sequence:CCGGCCAGTATCTTACTGTGTTATTCTCGAGAATAACACAGTAAGATACTGGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000190255    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.88 Cell Line: 3T3-L1
TRC Version: 1 Clone ID:NM_025817.3-660s1c1
Sequence:CCGGCGGCAACTTCATCACCAACATCTCGAGATGTTGGTGATGAAGTTGCCGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339612    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025817.3-1660s21c1
Sequence:CCGGCTGGATTACCTGGATGACCAACTCGAGTTGGTCATCCAGGTAATCCAGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339611    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025817.3-660s21c1
Sequence:CCGGCGGCAACTTCATCACCAACATCTCGAGATGTTGGTGATGAAGTTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339686    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_025817.3-4253s21c1
Sequence:CCGGGCCAGTATCTTACTGTGTTATCTCGAGATAACACAGTAAGATACTGGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000339683    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_025817.3-567s21c1
Sequence:CCGGCCAACATCTCCTATGCACCAACTCGAGTTGGTGCATAGGAGATGTTGGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks