EMAIL THIS PAGE TO A FRIEND

TRIM10

tripartite motif containing 10

Synonyms: HERF1 RFB30 RNF9
Gene ID:
Human(10107) Summary: The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein localizes to cytoplasmic bodies. Studies in mice suggest that this protein plays a role in terminal differentiation of erythroid cells. Alternate splicing of this gene generates two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Mouse(19824) tripartite motif-containing 10
Rat(294210) tripartite motif-containing 10
dog(488345) tripartite motif containing 10
Horse(100051786) tripartite motif containing 10
domestic cat(101098631) tripartite motif containing 10
naked mole-rat(101713800) tripartite motif containing 10
cow(515628) tripartite motif containing 10
sheep(101112008) tripartite motif containing 10
107 Gene Product Result for
Custom Gene Products
Our expertise in DNA & RNA oligo design, chemistry and manufacturing enable Sigma Custom Products to provide a comprehensive product portfolio. Learn more about our "custom capabilities & extensive options today."

shRNA

Type Description Species Add to Cart
 
SHCLNG-NM_006778 MISSION® shRNA Bacterial Glycerol Stock human pricing
SHCLND-NM_006778 MISSION® shRNA Plasmid DNA human pricing
SHCLNV-NM_006778 MISSION® shRNA Lentiviral Transduction Particles human pricing
SHCLNG-NM_011280 MISSION® shRNA Bacterial Glycerol Stock mouse pricing
SHCLND-NM_011280 MISSION® shRNA Plasmid DNA mouse pricing
SHCLNV-NM_011280 MISSION® shRNA Lentiviral Transduction Particles mouse pricing

esiRNA

Product # Description Species Add to Cart
 
EHU127941 MISSION® esiRNA esiRNA human TRIM10 (esiRNA1) human pricing

Custom CRISPR Plasmid

Product # Description  
 
CRISPR Custom CRISPR Plasmid for gene knockout

siRNA

siRNA ranking are listed in order of expected efficacy (1 being the best) as predicted by the Rosetta algorithm.
All predesigned siRNA carry the Sigma-Aldrich guarantee.
Product # siRNA Type Species  
 
NM_006778 Rosetta Predictions human pricing
NM_052828 Rosetta Predictions human pricing
NM_001009176 Rosetta Predictions rat pricing
XM_579280 Rosetta Predictions rat pricing
NM_011280 Rosetta Predictions mouse pricing
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_006778 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00158894 predicted 842
2 SASI_Hs02_00342285 predicted 516
3 SASI_Hs02_00342286 predicted 618
4 SASI_Hs01_00158895 predicted 829
5 SASI_Hs02_00342287 predicted 496
6 SASI_Hs02_00342288 predicted 724
7 SASI_Hs01_00158896 predicted 837
8 SASI_Hs02_00342289 predicted 712
9 SASI_Hs02_00342290 predicted 680
10 SASI_Hs02_00342291 predicted 609
11 SASI_Hs01_00158893 predicted 818
12 SASI_Hs01_00158897 predicted 301
13 SASI_Hs01_00158898 predicted 267
14 SASI_Hs01_00158899 predicted 846
15 SASI_Hs01_00158900 predicted 283
16 SASI_Hs01_00158901 predicted 821
17 SASI_Hs01_00158902 predicted 836
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_052828 Rosetta Predictions Human
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Hs01_00246245 predicted 843
2 SASI_Hs02_00361503 predicted 514
3 SASI_Hs02_00361504 predicted 624
4 SASI_Hs01_00246246 predicted 826
5 SASI_Hs02_00361505 predicted 1722
6 SASI_Hs02_00361506 predicted 490
7 SASI_Hs02_00361507 predicted 728
8 SASI_Hs01_00246247 predicted 836
9 SASI_Hs02_00361508 predicted 710
10 SASI_Hs02_00361509 predicted 680
11 SASI_Hs01_00246244 predicted 813
12 SASI_Hs01_00246248 predicted 301
13 SASI_Hs01_00246249 predicted 266
14 SASI_Hs01_00246250 predicted 847
15 SASI_Hs01_00246251 predicted 290
16 SASI_Hs01_00246252 predicted 822
17 SASI_Hs01_00246253 predicted 830
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_001009176 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00068929 predicted 1376
2 SASI_Rn01_00068930 predicted 1493
3 SASI_Rn01_00068931 predicted 1491
4 SASI_Rn01_00068932 predicted 1128
5 SASI_Rn01_00068933 predicted 578
6 SASI_Rn01_00068934 predicted 1505
7 SASI_Rn01_00068935 predicted 826
8 SASI_Rn01_00068936 predicted 1911
9 SASI_Rn01_00068937 predicted 1370
10 SASI_Rn01_00068938 predicted 1380
siRNA
PRODUCT # siRNA Type ? SPECIES
XM_579280 Rosetta Predictions Rat
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Rn01_00178460 predicted 525
2 SASI_Rn01_00178461 predicted 282
3 SASI_Rn01_00178462 predicted 502
4 SASI_Rn01_00178463 predicted 298
5 SASI_Rn01_00178464 predicted 387
6 SASI_Rn01_00178465 predicted 353
7 SASI_Rn01_00178466 predicted 473
8 SASI_Rn01_00178467 predicted 340
9 SASI_Rn01_00178468 predicted 343
10 SASI_Rn01_00178469 predicted 347
siRNA
PRODUCT # siRNA Type ? SPECIES
NM_011280 Rosetta Predictions Mouse
Ranking siRNA ID Sequence Start ? Purification Size ? Price Select
1 SASI_Mm01_00120033 predicted 1051
2 SASI_Mm01_00120034 predicted 1301
3 SASI_Mm01_00120035 predicted 1825
4 SASI_Mm01_00120036 predicted 1311
5 SASI_Mm01_00120038 predicted 1830
6 SASI_Mm01_00120039 predicted 1370
7 SASI_Mm01_00120040 predicted 512
8 SASI_Mm01_00120041 predicted 1039
9 SASI_Mm01_00120042 predicted 1036
10 SASI_Mm02_00320322 predicted 1666
11 SASI_Mm01_00120037 predicted 1309
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_006778
VALIDATED
TRIM10 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 10
Human
9 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000235415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_006778.3-1068s21c1
Sequence:CCGGGAGCTCAGTTCTCCTACAAATCTCGAGATTTGTAGGAGAACTGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_006778.3-834s21c1
Sequence:CCGGACATCAGAAGCACTCTAATAACTCGAGTTATTAGAGTGCTTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006778.3-978s21c1
Sequence:CCGGTATGCTTTGAGTTGGACTATGCTCGAGCATAGTCCAACTCAAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006778.3-1170s21c1
Sequence:CCGGACACGTGGGTGGTGAGTATAGCTCGAGCTATACTCACCACCCACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000235418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006778.3-2648s21c1
Sequence:CCGGGAATTGAGACTACCGTAATTGCTCGAGCAATTACGGTAGTCTCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006778.2-1614s1c1
Sequence:CCGGCGGGATAGAAATGACTGCTTTCTCGAGAAAGCAGTCATTTCTATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006778.2-843s1c1
Sequence:CCGGGCACTCTAATAAGATGTGAAACTCGAGTTTCACATCTTATTAGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006778.2-977s1c1
Sequence:CCGGCTATGCTTTGAGTTGGACTATCTCGAGATAGTCCAACTCAAAGCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000007636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006778.2-302s1c1
Sequence:CCGGGCTAACGTGGTGGAGAACATTCTCGAGAATGTTCTCCACCACGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_006778
VALIDATED
TRIM10 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 10
Human
9 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000235415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_006778.3-1068s21c1
Sequence:CCGGGAGCTCAGTTCTCCTACAAATCTCGAGATTTGTAGGAGAACTGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_006778.3-834s21c1
Sequence:CCGGACATCAGAAGCACTCTAATAACTCGAGTTATTAGAGTGCTTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006778.3-978s21c1
Sequence:CCGGTATGCTTTGAGTTGGACTATGCTCGAGCATAGTCCAACTCAAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006778.3-1170s21c1
Sequence:CCGGACACGTGGGTGGTGAGTATAGCTCGAGCTATACTCACCACCCACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000235418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006778.3-2648s21c1
Sequence:CCGGGAATTGAGACTACCGTAATTGCTCGAGCAATTACGGTAGTCTCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006778.2-1614s1c1
Sequence:CCGGCGGGATAGAAATGACTGCTTTCTCGAGAAAGCAGTCATTTCTATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006778.2-843s1c1
Sequence:CCGGGCACTCTAATAAGATGTGAAACTCGAGTTTCACATCTTATTAGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006778.2-977s1c1
Sequence:CCGGCTATGCTTTGAGTTGGACTATCTCGAGATAGTCCAACTCAAAGCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000007636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006778.2-302s1c1
Sequence:CCGGGCTAACGTGGTGGAGAACATTCTCGAGAATGTTCTCCACCACGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_006778
VALIDATED
TRIM10 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 10
Human
9 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000235415    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.59 Cell Line: A549
TRC Version: 2 Clone ID:NM_006778.3-1068s21c1
Sequence:CCGGGAGCTCAGTTCTCCTACAAATCTCGAGATTTGTAGGAGAACTGAGCTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235419    
Product Details
Validated
Region:CDS Mean KnockDown Level: 0.58 Cell Line: A549
TRC Version: 2 Clone ID:NM_006778.3-834s21c1
Sequence:CCGGACATCAGAAGCACTCTAATAACTCGAGTTATTAGAGTGCTTCTGATGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235416    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006778.3-978s21c1
Sequence:CCGGTATGCTTTGAGTTGGACTATGCTCGAGCATAGTCCAACTCAAAGCATATTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235417    
Product Details

Region:CDS
TRC Version: 2 Clone ID:NM_006778.3-1170s21c1
Sequence:CCGGACACGTGGGTGGTGAGTATAGCTCGAGCTATACTCACCACCCACGTGTTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000235418    
Product Details

Region:3UTR
TRC Version: 2 Clone ID:NM_006778.3-2648s21c1
Sequence:CCGGGAATTGAGACTACCGTAATTGCTCGAGCAATTACGGTAGTCTCAATTCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007634    
Product Details

Region:3UTR
TRC Version: 1 Clone ID:NM_006778.2-1614s1c1
Sequence:CCGGCGGGATAGAAATGACTGCTTTCTCGAGAAAGCAGTCATTTCTATCCCGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007635    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006778.2-843s1c1
Sequence:CCGGGCACTCTAATAAGATGTGAAACTCGAGTTTCACATCTTATTAGAGTGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007638    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006778.2-977s1c1
Sequence:CCGGCTATGCTTTGAGTTGGACTATCTCGAGATAGTCCAACTCAAAGCATAGTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000007636    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_006778.2-302s1c1
Sequence:CCGGGCTAACGTGGTGGAGAACATTCTCGAGAATGTTCTCCACCACGTTAGCTTTTT
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNG-NM_011280
TRIM10 MISSION shRNA Bacterial Glycerol Stock
tripartite motif containing 10
Mouse
6 Products Total
TRC Number Price Set Price (5+)? Select
TRCN0000174058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011280.1-1671s1c2
Sequence:CCGGCAGAAGATCTTTCCCTTGTTTCTCGAGAAACAAGGGAAAGATCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011280.1-1158s1c1
Sequence:CCGGCGGCAGGAGATGAAGACATTTCTCGAGAAATGTCTTCATCTCCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011280.1-833s1c1
Sequence:CCGGGCAACAGGTGATCTCACAGTTCTCGAGAACTGTGAGATCACCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011280.1-726s1c1
Sequence:CCGGCAGAAGTGTCTCGTGTGTCTACTCGAGTAGACACACGAGACACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011280.1-1584s1c1
Sequence:CCGGGTATCTCTTGACTATGAGGTACTCGAGTACCTCATAGTCAAGAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
TRCN0000040615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011280.1-1671s1c1
Sequence:CCGGCAGAAGATCTTTCCCTTGTTTCTCGAGAAACAAGGGAAAGATCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 48 hours
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLND-NM_011280
TRIM10 MISSION shRNA shRNA Plasmid DNA
tripartite motif containing 10
Mouse
6 Products Total
TRC Number Vector Price Set Price (5+)? Select
TRCN0000174058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011280.1-1671s1c2
Sequence:CCGGCAGAAGATCTTTCCCTTGTTTCTCGAGAAACAAGGGAAAGATCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011280.1-1158s1c1
Sequence:CCGGCGGCAGGAGATGAAGACATTTCTCGAGAAATGTCTTCATCTCCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011280.1-833s1c1
Sequence:CCGGGCAACAGGTGATCTCACAGTTCTCGAGAACTGTGAGATCACCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011280.1-726s1c1
Sequence:CCGGCAGAAGTGTCTCGTGTGTCTACTCGAGTAGACACACGAGACACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011280.1-1584s1c1
Sequence:CCGGGTATCTCTTGACTATGAGGTACTCGAGTACCTCATAGTCAAGAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
TRCN0000040615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011280.1-1671s1c1
Sequence:CCGGCAGAAGATCTTTCCCTTGTTTCTCGAGAAACAAGGGAAAGATCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 2 weeks, custom formats typically 4-5 weeks
shRNA
PRODUCT TYPE PRODUCT NAME SPECIES
SHCLNV-NM_011280
TRIM10 MISSION shRNA Lentiviral Transduction Particles
tripartite motif containing 10
Mouse
6 Products Total
TRC Number Volume Titer Vector Price Set Price (5+)? Select
TRCN0000174058    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011280.1-1671s1c2
Sequence:CCGGCAGAAGATCTTTCCCTTGTTTCTCGAGAAACAAGGGAAAGATCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040613    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011280.1-1158s1c1
Sequence:CCGGCGGCAGGAGATGAAGACATTTCTCGAGAAATGTCTTCATCTCCTGCCGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040614    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011280.1-833s1c1
Sequence:CCGGGCAACAGGTGATCTCACAGTTCTCGAGAACTGTGAGATCACCTGTTGCTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040616    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011280.1-726s1c1
Sequence:CCGGCAGAAGTGTCTCGTGTGTCTACTCGAGTAGACACACGAGACACTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040617    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011280.1-1584s1c1
Sequence:CCGGGTATCTCTTGACTATGAGGTACTCGAGTACCTCATAGTCAAGAGATACTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks
TRCN0000040615    
Product Details

Region:CDS
TRC Version: 1 Clone ID:NM_011280.1-1671s1c1
Sequence:CCGGCAGAAGATCTTTCCCTTGTTTCTCGAGAAACAAGGGAAAGATCTTCTGTTTTTG
Availability: Produced on-demand (St. Louis, USA), standard format typically within 4 weeks, custom formats typically 6-8 weeks